\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419763927:

Variant ID: vg0419763927 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 19763927
Reference Allele: GCAlternative Allele: AC,G
Primary Allele: GCSecondary Allele: AC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGACAAGCGGGTCCCACCCGGGACCACGCAAGGTGGACCCGGCCCACCGTCACCCTCTCTCCTCTCCGCCCGCGCGCGCGCTTTGGGCCGCCTTCTTGG[GC/AC,G]
CGGCCGGCCCATTTAGCTCGGCCGAGCCGCCCCTTCCTCTCGAGCCGCGCCCTAGCCGCCCGAGGGAAGTCTGATTTCCCTCCCTCCTTCTTTTCTTTTC

Reverse complement sequence

GAAAAGAAAAGAAGGAGGGAGGGAAATCAGACTTCCCTCGGGCGGCTAGGGCGCGGCTCGAGAGGAAGGGGCGGCTCGGCCGAGCTAAATGGGCCGGCCG[GC/GT,C]
CCAAGAAGGCGGCCCAAAGCGCGCGCGCGGGCGGAGAGGAGAGAGGGTGACGGTGGGCCGGGTCCACCTTGCGTGGTCCCGGGTGGGACCCGCTTGTCGG

Allele Frequencies:

Populations Population SizeFrequency of GC(primary allele) Frequency of AC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 0.30% 2.50% 11.30% G: 0.02%
All Indica  2759 82.30% 0.00% 2.83% 14.86% NA
All Japonica  1512 92.50% 0.50% 1.98% 4.96% NA
Aus  269 84.80% 0.00% 1.86% 13.38% NA
Indica I  595 77.50% 0.00% 4.03% 18.49% NA
Indica II  465 79.60% 0.00% 2.15% 18.28% NA
Indica III  913 89.90% 0.00% 0.99% 9.09% NA
Indica Intermediate  786 78.80% 0.00% 4.45% 16.79% NA
Temperate Japonica  767 86.60% 0.50% 3.39% 9.52% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 97.50% 0.40% 1.66% 0.41% NA
VI/Aromatic  96 92.70% 4.20% 2.08% 1.04% NA
Intermediate  90 81.10% 1.10% 3.33% 13.33% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419763927 GC -> DEL N N silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> AC LOC_Os04g32770.1 upstream_gene_variant ; 2099.0bp to feature; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> AC LOC_Os04g32760.1 downstream_gene_variant ; 1919.0bp to feature; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> AC LOC_Os04g32760-LOC_Os04g32770 intergenic_region ; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> G LOC_Os04g32770.1 upstream_gene_variant ; 2098.0bp to feature; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> G LOC_Os04g32760.1 downstream_gene_variant ; 1920.0bp to feature; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N
vg0419763927 GC -> G LOC_Os04g32760-LOC_Os04g32770 intergenic_region ; MODIFIER silent_mutation Average:17.712; most accessible tissue: Callus, score: 36.897 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419763927 2.50E-06 3.94E-06 mr1043_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 4.55E-06 2.52E-06 mr1070_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 4.74E-06 NA mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 1.08E-06 NA mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 1.66E-07 8.69E-07 mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 4.91E-07 4.91E-07 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 3.64E-06 5.27E-07 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 4.18E-06 4.18E-06 mr1216_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 3.36E-09 1.06E-08 mr1227_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 NA 6.50E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 5.74E-07 5.74E-07 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 2.02E-06 3.53E-06 mr1269_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 6.19E-07 7.12E-07 mr1291_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 6.06E-06 4.00E-06 mr1344_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 1.22E-06 1.17E-06 mr1405_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 5.34E-08 5.52E-07 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 3.02E-06 3.69E-06 mr1437_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 5.42E-07 2.93E-07 mr1457_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 9.43E-06 6.69E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 3.50E-07 7.15E-07 mr1479_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 9.03E-06 NA mr1502_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 5.54E-06 5.54E-06 mr1516_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 1.84E-06 1.84E-06 mr1574_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 2.23E-06 5.07E-06 mr1620_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 7.82E-07 7.82E-07 mr1704_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 5.03E-06 NA mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 9.28E-06 1.30E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419763927 1.57E-07 1.57E-07 mr1878_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251