\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419597707:

Variant ID: vg0419597707 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 19597707
Reference Allele: CAlternative Allele: T,CCCGA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATGAATCTCTAGCCTCTGAAAATGCTATTATAATTCCGAAGTCCAATTCCTGGAAGAAAAAAAAAAGAACTTCTAGCCGCGCTCTTCGGTTCAAGTT[C/T,CCCGA]
CCAACCTCACTCTCTCGTTTACCGCGCACACGCTTCCCAAACTGCTAAACGGTGCGTGGTTTGTAAAAAGTTTCTATAGAAAATTTGATTTAAAAAAATC

Reverse complement sequence

GATTTTTTTAAATCAAATTTTCTATAGAAACTTTTTACAAACCACGCACCGTTTAGCAGTTTGGGAAGCGTGTGCGCGGTAAACGAGAGAGTGAGGTTGG[G/A,TCGGG]
AACTTGAACCGAAGAGCGCGGCTAGAAGTTCTTTTTTTTTTCTTCCAGGAATTGGACTTCGGAATTATAATAGCATTTTCAGAGGCTAGAGATTCATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 6.10% 0.23% 0.00% CCCGA: 0.02%
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 82.30% 17.10% 0.53% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 57.70% 41.10% 1.19% 0.00% NA
Japonica Intermediate  241 83.40% 15.80% 0.83% 0.00% NA
VI/Aromatic  96 84.40% 13.50% 1.04% 0.00% CCCGA: 1.04%
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419597707 C -> CCCGA LOC_Os04g32550.1 upstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> CCCGA LOC_Os04g32540.1 downstream_gene_variant ; 2144.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> CCCGA LOC_Os04g32560.1 downstream_gene_variant ; 3586.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> CCCGA LOC_Os04g32540.2 downstream_gene_variant ; 2144.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> CCCGA LOC_Os04g32560.2 downstream_gene_variant ; 3579.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> CCCGA LOC_Os04g32540-LOC_Os04g32550 intergenic_region ; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32550.1 upstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32540.1 downstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32560.1 downstream_gene_variant ; 3587.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32540.2 downstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32560.2 downstream_gene_variant ; 3580.0bp to feature; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0419597707 C -> T LOC_Os04g32540-LOC_Os04g32550 intergenic_region ; MODIFIER silent_mutation Average:82.452; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419597707 C CCCGA -0.12 -0.19 -0.1 -0.17 -0.13 -0.17
vg0419597707 C T -0.02 -0.03 -0.03 -0.03 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419597707 NA 2.57E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 7.17E-11 mr1194 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 7.02E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 7.51E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 5.89E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.71E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 4.49E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 1.48E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 8.29E-06 mr1546 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.49E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 8.46E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 1.29E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.93E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 9.29E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.44E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.21E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 9.11E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 7.52E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 4.66E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 1.34E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 9.24E-09 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 2.39E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 5.13E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 4.46E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 3.52E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 8.65E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 1.40E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 9.62E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419597707 NA 9.04E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251