\
| Variant ID: vg0419568634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19568634 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 119. )
CATTTTTTTTCAAAAGTAAAAAATTTAAAGCCTGGATGAAACACTTAATATTTAGTTCTTTTTATTTGCGGGTGCTCGATAAAACACTTGATGGGTATTC[T/C]
TGGAATTAAAAATCACATGCGTTTAATTTTCAAATAATCACAAAACCCACAAATATTGCCTTAATTAAAATCGATATTGAGGTTTGCTTTTAGGAAAAAA
TTTTTTCCTAAAAGCAAACCTCAATATCGATTTTAATTAAGGCAATATTTGTGGGTTTTGTGATTATTTGAAAATTAAACGCATGTGATTTTTAATTCCA[A/G]
GAATACCCATCAAGTGTTTTATCGAGCACCCGCAAATAAAAAGAACTAAATATTAAGTGTTTCATCCAGGCTTTAAATTTTTTACTTTTGAAAAAAAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 39.40% | 0.36% | 0.38% | NA |
| All Indica | 2759 | 92.80% | 6.60% | 0.22% | 0.40% | NA |
| All Japonica | 1512 | 4.00% | 95.20% | 0.60% | 0.20% | NA |
| Aus | 269 | 69.90% | 30.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 8.90% | 0.67% | 1.01% | NA |
| Indica II | 465 | 90.80% | 8.80% | 0.00% | 0.43% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.20% | 0.25% | 0.38% | NA |
| Temperate Japonica | 767 | 6.60% | 92.20% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.50% | 96.70% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 22.20% | 71.10% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419568634 | T -> C | LOC_Os04g32510.1 | downstream_gene_variant ; 2314.0bp to feature; MODIFIER | silent_mutation | Average:43.299; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0419568634 | T -> C | LOC_Os04g32510-LOC_Os04g32540 | intergenic_region ; MODIFIER | silent_mutation | Average:43.299; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0419568634 | T -> DEL | N | N | silent_mutation | Average:43.299; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419568634 | NA | 1.81E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 7.16E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 1.15E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 4.73E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 1.71E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | 4.03E-06 | NA | mr1347 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | 1.36E-06 | 1.36E-06 | mr1461 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 1.35E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 6.77E-08 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | 7.91E-06 | 4.60E-06 | mr1741 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 9.32E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 3.15E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 2.11E-07 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 3.90E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 2.94E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 2.38E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419568634 | NA | 7.45E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |