\
| Variant ID: vg0419360666 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19360666 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )
TTTCTTTACATGTGGGCTAGCTTGTTAACTTTGTATGATCCCCTGATAGGAATAAGTCCACTTTGACTCCCACAATTACAAGTGCAATCTGATTCATATC[C/T]
CTTAACCAAAATAAAGATATTTTGACCCCTCAAAAATGACACCTCCAGTGGTTTTGAAGGTGGTTTTCGCTGACGTGTCGAATTGACTTGTCTCTGAGTG
CACTCAGAGACAAGTCAATTCGACACGTCAGCGAAAACCACCTTCAAAACCACTGGAGGTGTCATTTTTGAGGGGTCAAAATATCTTTATTTTGGTTAAG[G/A]
GATATGAATCAGATTGCACTTGTAATTGTGGGAGTCAAAGTGGACTTATTCCTATCAGGGGATCATACAAAGTTAACAAGCTAGCCCACATGTAAAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 4.10% | 1.59% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 6.90% | 2.68% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.40% | 21.20% | 9.41% | 0.00% | NA |
| Indica II | 465 | 95.70% | 3.00% | 1.29% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 6.40% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419360666 | C -> T | LOC_Os04g32300.1 | downstream_gene_variant ; 3859.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0419360666 | C -> T | LOC_Os04g32300-LOC_Os04g32310 | intergenic_region ; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419360666 | NA | 5.01E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | NA | 6.99E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 6.81E-08 | 1.83E-11 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 7.06E-07 | 7.47E-10 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 3.43E-06 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 1.37E-10 | 4.65E-15 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 1.37E-09 | 1.73E-13 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 7.32E-08 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 5.75E-07 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 1.29E-08 | 1.05E-12 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419360666 | 6.67E-08 | 5.99E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |