\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419266577:

Variant ID: vg0419266577 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19266577
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATCTGAATAAGACTTTGCACTTCAGAATGTTTCCTTGTTCTTTATTCGATCTGGAGAATACGTTTGTGGCAGATAAAAAAGGGAATTAATGGCGCC[A/G]
AAATAAATCTTATTAGGCCCCATTTAAAATAGAAATGAAGTCGTGTGTATAAAATTTCTGTGAAATTCTGTAAAATTCTTACATTTCGAATAGGGTTGTA

Reverse complement sequence

TACAACCCTATTCGAAATGTAAGAATTTTACAGAATTTCACAGAAATTTTATACACACGACTTCATTTCTATTTTAAATGGGGCCTAATAAGATTTATTT[T/C]
GGCGCCATTAATTCCCTTTTTTATCTGCCACAAACGTATTCTCCAGATCGAATAAAGAACAAGGAAACATTCTGAAGTGCAAAGTCTTATTCAGATTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 30.70% 1.84% 0.19% NA
All Indica  2759 86.30% 12.80% 0.72% 0.14% NA
All Japonica  1512 37.00% 58.80% 3.97% 0.20% NA
Aus  269 72.50% 27.10% 0.37% 0.00% NA
Indica I  595 82.40% 15.10% 2.35% 0.17% NA
Indica II  465 65.60% 34.00% 0.22% 0.22% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 86.90% 12.20% 0.64% 0.25% NA
Temperate Japonica  767 64.90% 29.70% 5.35% 0.00% NA
Tropical Japonica  504 2.00% 95.80% 2.18% 0.00% NA
Japonica Intermediate  241 21.60% 73.90% 3.32% 1.24% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 48.90% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419266577 A -> DEL N N silent_mutation Average:59.357; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0419266577 A -> G LOC_Os04g32100.1 upstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:59.357; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0419266577 A -> G LOC_Os04g32110.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:59.357; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0419266577 A -> G LOC_Os04g32090-LOC_Os04g32100 intergenic_region ; MODIFIER silent_mutation Average:59.357; most accessible tissue: Minghui63 root, score: 85.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419266577 NA 1.20E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419266577 NA 7.71E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419266577 NA 2.03E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419266577 NA 8.24E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.16E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 9.70E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 7.46E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 2.48E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 5.28E-06 4.45E-09 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 6.06E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 8.57E-08 1.17E-18 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.80E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.89E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.27E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 3.27E-22 6.59E-31 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 7.77E-11 2.78E-13 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 2.00E-07 2.21E-11 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 3.51E-20 1.39E-36 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 3.41E-12 5.80E-17 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 1.23E-06 9.34E-14 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 8.64E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 2.72E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 9.05E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 6.89E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 6.63E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 2.08E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 6.05E-07 1.15E-21 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 9.83E-12 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 3.64E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.57E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.04E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 6.42E-10 6.79E-20 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 4.10E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 2.11E-08 3.71E-23 mr1864_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 2.78E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 9.49E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419266577 NA 1.12E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251