\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419265062:

Variant ID: vg0419265062 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19265062
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAAAATGACTATTTACCCCTAATTTAACACCGTTAACTCACCTTAACGGAATAGGGTTAGATAGCAGGTTTGTTTGTAAAAAGGAGGGTCAAATAAG[C/T]
AAACTAGAAAAAGTAGGGTCAAATTGGTAGTTAGACTTTAAAACAGGGTTAAATAAACAATTGCCCCATATGAAATCTATTAATTGTACCTTCCAGGTTC

Reverse complement sequence

GAACCTGGAAGGTACAATTAATAGATTTCATATGGGGCAATTGTTTATTTAACCCTGTTTTAAAGTCTAACTACCAATTTGACCCTACTTTTTCTAGTTT[G/A]
CTTATTTGACCCTCCTTTTTACAAACAAACCTGCTATCTAACCCTATTCCGTTAAGGTGAGTTAACGGTGTTAAATTAGGGGTAAATAGTCATTTTTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 30.70% 1.65% 0.25% NA
All Indica  2759 86.30% 12.90% 0.69% 0.14% NA
All Japonica  1512 37.60% 58.70% 3.44% 0.33% NA
Aus  269 72.50% 27.10% 0.37% 0.00% NA
Indica I  595 82.40% 15.30% 2.18% 0.17% NA
Indica II  465 65.40% 34.20% 0.22% 0.22% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 87.00% 12.20% 0.51% 0.25% NA
Temperate Japonica  767 65.80% 29.50% 4.69% 0.00% NA
Tropical Japonica  504 2.00% 95.80% 1.79% 0.40% NA
Japonica Intermediate  241 22.00% 73.90% 2.90% 1.24% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 41.10% 50.00% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419265062 C -> DEL N N silent_mutation Average:59.828; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0419265062 C -> T LOC_Os04g32100.1 upstream_gene_variant ; 2094.0bp to feature; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0419265062 C -> T LOC_Os04g32110.1 upstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0419265062 C -> T LOC_Os04g32090-LOC_Os04g32100 intergenic_region ; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 root, score: 85.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419265062 NA 5.31E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419265062 NA 1.09E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419265062 NA 1.09E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419265062 NA 9.46E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 4.46E-06 3.93E-09 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 7.90E-07 1.96E-17 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.83E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 8.75E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 1.34E-20 4.59E-30 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 7.55E-11 2.99E-13 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 1.86E-06 9.34E-11 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 1.05E-20 2.44E-37 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 9.08E-12 2.66E-16 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 4.17E-08 1.88E-15 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.06E-06 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 2.92E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 4.70E-07 1.43E-21 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 3.61E-12 mr1521_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 6.37E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.58E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 2.77E-08 3.46E-18 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.25E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 1.95E-07 3.99E-22 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 3.77E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.22E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419265062 NA 1.88E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251