\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419261408:

Variant ID: vg0419261408 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19261408
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGCAAAGATGACACATCATCATCCACTAACAAGATAACGTATCATCATCCACTAATTAACAAGATGCTACATCATCATCCACTAACAATCATCACAT[T/C]
TAAACATCATGCAAGCACGCTATATCTTTATAGTTTTTATAATTTAAGAGCTTTTCAAATACAAACATATTAAATTAAATTATCATCCAACATAATTCAC

Reverse complement sequence

GTGAATTATGTTGGATGATAATTTAATTTAATATGTTTGTATTTGAAAAGCTCTTAAATTATAAAAACTATAAAGATATAGCGTGCTTGCATGATGTTTA[A/G]
ATGTGATGATTGTTAGTGGATGATGATGTAGCATCTTGTTAATTAGTGGATGATGATACGTTATCTTGTTAGTGGATGATGATGTGTCATCTTTGCATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 9.40% 1.57% 0.00% NA
All Indica  2759 97.50% 1.50% 1.05% 0.00% NA
All Japonica  1512 77.80% 19.50% 2.71% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 92.10% 3.70% 4.20% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.00% 0.38% 0.00% NA
Temperate Japonica  767 94.80% 3.00% 2.22% 0.00% NA
Tropical Japonica  504 56.50% 40.30% 3.17% 0.00% NA
Japonica Intermediate  241 68.00% 28.60% 3.32% 0.00% NA
VI/Aromatic  96 72.90% 25.00% 2.08% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419261408 T -> C LOC_Os04g32090-LOC_Os04g32100 intergenic_region ; MODIFIER silent_mutation Average:34.098; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419261408 NA 2.04E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 NA 2.14E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 4.06E-06 2.39E-13 mr1864 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 NA 5.74E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 3.00E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 4.14E-09 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 NA 1.74E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408 NA 5.65E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251