\
| Variant ID: vg0419261408 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19261408 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 227. )
ACATGCAAAGATGACACATCATCATCCACTAACAAGATAACGTATCATCATCCACTAATTAACAAGATGCTACATCATCATCCACTAACAATCATCACAT[T/C]
TAAACATCATGCAAGCACGCTATATCTTTATAGTTTTTATAATTTAAGAGCTTTTCAAATACAAACATATTAAATTAAATTATCATCCAACATAATTCAC
GTGAATTATGTTGGATGATAATTTAATTTAATATGTTTGTATTTGAAAAGCTCTTAAATTATAAAAACTATAAAGATATAGCGTGCTTGCATGATGTTTA[A/G]
ATGTGATGATTGTTAGTGGATGATGATGTAGCATCTTGTTAATTAGTGGATGATGATACGTTATCTTGTTAGTGGATGATGATGTGTCATCTTTGCATGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 9.40% | 1.57% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 1.50% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 77.80% | 19.50% | 2.71% | 0.00% | NA |
| Aus | 269 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 3.70% | 4.20% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 3.00% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 56.50% | 40.30% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 28.60% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 25.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419261408 | T -> C | LOC_Os04g32090-LOC_Os04g32100 | intergenic_region ; MODIFIER | silent_mutation | Average:34.098; most accessible tissue: Zhenshan97 root, score: 72.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419261408 | NA | 2.04E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | NA | 2.14E-08 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | 4.06E-06 | 2.39E-13 | mr1864 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | NA | 5.74E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | 3.00E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | 4.14E-09 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | NA | 1.74E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419261408 | NA | 5.65E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |