\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419235485:

Variant ID: vg0419235485 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19235485
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.21, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAGAAAAATACCGAACCAAAATGACCGAGACAAAAACTAACCGAGATCGAATTAACCGAAAAAACCGAATATATCACTGGCCCAATAACATGACAAA[A/T]
ACTAACCGAGATCGAATTAACCGAAAAAACCGAATATATCACTGGCCCAATAACATGTATGATATGTCTAGGGGTGGAAAAAAAGCTCGAGCTCGTGAGT

Reverse complement sequence

ACTCACGAGCTCGAGCTTTTTTTCCACCCCTAGACATATCATACATGTTATTGGGCCAGTGATATATTCGGTTTTTTCGGTTAATTCGATCTCGGTTAGT[T/A]
TTTGTCATGTTATTGGGCCAGTGATATATTCGGTTTTTTCGGTTAATTCGATCTCGGTTAGTTTTTGTCTCGGTCATTTTGGTTCGGTATTTTTCTGCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.50% 12.50% 18.39% 39.61% NA
All Indica  2759 12.10% 1.40% 22.25% 64.26% NA
All Japonica  1512 56.20% 34.80% 7.80% 1.19% NA
Aus  269 27.90% 3.00% 44.61% 24.54% NA
Indica I  595 16.00% 1.00% 8.57% 74.45% NA
Indica II  465 25.80% 3.20% 18.71% 52.26% NA
Indica III  913 1.00% 1.10% 35.60% 62.32% NA
Indica Intermediate  786 14.00% 0.90% 19.21% 65.90% NA
Temperate Japonica  767 30.40% 62.10% 6.26% 1.30% NA
Tropical Japonica  504 91.90% 1.40% 5.56% 1.19% NA
Japonica Intermediate  241 63.90% 17.80% 17.43% 0.83% NA
VI/Aromatic  96 91.70% 0.00% 5.21% 3.12% NA
Intermediate  90 54.40% 18.90% 13.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419235485 A -> DEL N N silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32080.1 upstream_gene_variant ; 1185.0bp to feature; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32060.2 downstream_gene_variant ; 3605.0bp to feature; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32070.1 downstream_gene_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32090.1 downstream_gene_variant ; 4895.0bp to feature; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32060.1 downstream_gene_variant ; 3605.0bp to feature; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N
vg0419235485 A -> T LOC_Os04g32070-LOC_Os04g32080 intergenic_region ; MODIFIER silent_mutation Average:58.86; most accessible tissue: Zhenshan97 root, score: 93.988 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419235485 A T 0.03 0.03 0.02 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419235485 NA 9.56E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419235485 NA 1.49E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419235485 NA 7.23E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 5.79E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 1.43E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 8.88E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 1.05E-07 1.45E-10 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 5.28E-08 3.14E-18 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 8.38E-06 8.38E-06 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 5.14E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 1.49E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 4.94E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 1.82E-28 1.59E-38 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 2.95E-15 1.50E-18 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 1.24E-08 7.63E-13 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 2.67E-24 6.85E-40 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 2.08E-11 2.93E-15 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 8.75E-12 1.47E-19 mr1864 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 3.47E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 3.57E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 5.99E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 2.40E-07 8.84E-21 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 1.07E-10 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 6.15E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 4.26E-10 7.20E-19 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 5.47E-06 8.96E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 6.76E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 2.10E-08 5.51E-21 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419235485 NA 1.36E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251