\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419232798:

Variant ID: vg0419232798 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19232798
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATAACTTGCATACTAATTTGATATGAAAGTTGGACTTCTCATTGCAGCTCATGATTTTTTTTTTAAAAAAGCGAATTCTCACAATAAATTTTATCC[C/T]
AACTAAAACGTATAATAATAATAAGATTAAAATAGTATTCATCTATTACAACGCACGAATATTTTTTCTAGTCAATATAAAAGTGACAAAACTTTTACCC

Reverse complement sequence

GGGTAAAAGTTTTGTCACTTTTATATTGACTAGAAAAAATATTCGTGCGTTGTAATAGATGAATACTATTTTAATCTTATTATTATTATACGTTTTAGTT[G/A]
GGATAAAATTTATTGTGAGAATTCGCTTTTTTAAAAAAAAAATCATGAGCTGCAATGAGAAGTCCAACTTTCATATCAAATTAGTATGCAAGTTATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 34.80% 0.38% 0.00% NA
All Indica  2759 83.40% 16.30% 0.33% 0.00% NA
All Japonica  1512 34.90% 64.60% 0.46% 0.00% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 79.20% 20.30% 0.50% 0.00% NA
Indica II  465 61.70% 38.10% 0.22% 0.00% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 81.60% 17.90% 0.51% 0.00% NA
Temperate Japonica  767 62.10% 37.30% 0.65% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 17.80% 81.30% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419232798 C -> T LOC_Os04g32070.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:66.617; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0419232798 C -> T LOC_Os04g32080.1 upstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:66.617; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0419232798 C -> T LOC_Os04g32060.2 downstream_gene_variant ; 918.0bp to feature; MODIFIER silent_mutation Average:66.617; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0419232798 C -> T LOC_Os04g32060.1 downstream_gene_variant ; 918.0bp to feature; MODIFIER silent_mutation Average:66.617; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0419232798 C -> T LOC_Os04g32060-LOC_Os04g32070 intergenic_region ; MODIFIER silent_mutation Average:66.617; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419232798 NA 4.98E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419232798 NA 4.94E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419232798 NA 2.82E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 1.69E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 1.18E-08 1.40E-11 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 9.92E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 8.48E-10 4.22E-20 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 2.77E-07 2.77E-07 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 1.05E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 5.76E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 3.06E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 1.48E-30 3.43E-40 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 4.00E-19 2.12E-21 mr1851 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 3.56E-08 2.61E-12 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 7.49E-28 2.50E-43 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 1.68E-16 3.06E-20 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 1.43E-10 6.42E-18 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 3.31E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 7.45E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 1.83E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 6.70E-09 1.60E-22 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 1.21E-06 2.63E-07 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 2.32E-11 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 3.96E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 8.05E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 4.11E-11 7.88E-20 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 2.94E-06 NA mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 6.93E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 2.74E-09 4.39E-22 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 3.21E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232798 NA 3.64E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251