\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419232304:

Variant ID: vg0419232304 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19232304
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGCACATAATCTCACACTCGGCCAGCTGCCCTAGAAAGACCCTCAAGTCGTTGTTCATCTTAATGGCCTAGGAACTCTGGTGCGAGAGAAATGCCTG[T/A]
ATCTTCAGACAGCGAGCTTCCATGCCCGCTATCATCATCGCCAAAATTAAAGAGGAGGCGCGAACCTGGATCGCGGCGGGAGCTGCAAAGCTCACAAAGA

Reverse complement sequence

TCTTTGTGAGCTTTGCAGCTCCCGCCGCGATCCAGGTTCGCGCCTCCTCTTTAATTTTGGCGATGATGATAGCGGGCATGGAAGCTCGCTGTCTGAAGAT[A/T]
CAGGCATTTCTCTCGCACCAGAGTTCCTAGGCCATTAAGATGAACAACGACTTGAGGGTCTTTCTAGGGCAGCTGGCCGAGTGTGAGATTATGTGCCACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.40% 0.15% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 63.90% 35.60% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 37.70% 61.90% 0.39% 0.00% NA
Tropical Japonica  504 94.80% 4.40% 0.79% 0.00% NA
Japonica Intermediate  241 82.60% 17.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419232304 T -> A LOC_Os04g32070.1 upstream_gene_variant ; 821.0bp to feature; MODIFIER silent_mutation Average:75.299; most accessible tissue: Callus, score: 93.053 N N N N
vg0419232304 T -> A LOC_Os04g32080.1 upstream_gene_variant ; 4366.0bp to feature; MODIFIER silent_mutation Average:75.299; most accessible tissue: Callus, score: 93.053 N N N N
vg0419232304 T -> A LOC_Os04g32060.2 downstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:75.299; most accessible tissue: Callus, score: 93.053 N N N N
vg0419232304 T -> A LOC_Os04g32060.1 downstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:75.299; most accessible tissue: Callus, score: 93.053 N N N N
vg0419232304 T -> A LOC_Os04g32060-LOC_Os04g32070 intergenic_region ; MODIFIER silent_mutation Average:75.299; most accessible tissue: Callus, score: 93.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419232304 NA 1.71E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419232304 NA 1.33E-13 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419232304 NA 8.48E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419232304 NA 1.40E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 4.43E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 3.64E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 2.29E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 8.95E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 1.53E-11 2.20E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 9.45E-09 1.30E-13 mr1851 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 5.65E-09 NA mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 1.32E-08 3.82E-16 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 1.09E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 8.48E-10 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419232304 NA 5.30E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251