Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0419225907:

Variant ID: vg0419225907 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19225907
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTCGAAAGGGCTTCCTGGAGGTTTTCTTCTTAGCAGCATAACACATTTGGAAACAACGAAATGGCTTAATCTTATAGAATATTCAGCCCTCCTTCCAAG[C/T]
TTGGAGATCACTTTTTGTGAAAGAGGTTCTTCTGCATATGTGCAGAATGAAGGATCCCTTAAAACAAATTGTTTCCGATTGGTTATAAACTTTATAGTTT

Reverse complement sequence

AAACTATAAAGTTTATAACCAATCGGAAACAATTTGTTTTAAGGGATCCTTCATTCTGCACATATGCAGAAGAACCTCTTTCACAAAAAGTGATCTCCAA[G/A]
CTTGGAAGGAGGGCTGAATATTCTATAAGATTAAGCCATTTCGTTGTTTCCAAATGTGTTATGCTGCTAAGAAGAAAACCTCCAGGAAGCCCTTTCGAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.60%	0.19%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	80.30%	19.20%	0.46%	0.00%	NA
Aus	269	72.50%	27.10%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.30%	2.30%	0.39%	0.00%	NA
Tropical Japonica	504	57.50%	41.70%	0.79%	0.00%	NA
Japonica Intermediate	241	73.90%	26.10%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419225907	C -> T	LOC_Os04g32060.2	upstream_gene_variant ; 1361.0bp to feature; MODIFIER	silent_mutation	Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0419225907	C -> T	LOC_Os04g32060.1	upstream_gene_variant ; 2211.0bp to feature; MODIFIER	silent_mutation	Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0419225907	C -> T	LOC_Os04g32050.1	downstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0419225907	C -> T	LOC_Os04g32050.2	downstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0419225907	C -> T	LOC_Os04g32050-LOC_Os04g32060	intergenic_region ; MODIFIER	silent_mutation	Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419225907	4.84E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	3.90E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	2.92E-08	NA	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	2.82E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	3.83E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	7.77E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	2.60E-09	NA	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	1.83E-12	3.61E-15	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	9.35E-15	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	6.69E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	7.32E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	2.48E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	1.68E-07	NA	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907	NA	8.80E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251