\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419225907:

Variant ID: vg0419225907 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19225907
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCGAAAGGGCTTCCTGGAGGTTTTCTTCTTAGCAGCATAACACATTTGGAAACAACGAAATGGCTTAATCTTATAGAATATTCAGCCCTCCTTCCAAG[C/T]
TTGGAGATCACTTTTTGTGAAAGAGGTTCTTCTGCATATGTGCAGAATGAAGGATCCCTTAAAACAAATTGTTTCCGATTGGTTATAAACTTTATAGTTT

Reverse complement sequence

AAACTATAAAGTTTATAACCAATCGGAAACAATTTGTTTTAAGGGATCCTTCATTCTGCACATATGCAGAAGAACCTCTTTCACAAAAAGTGATCTCCAA[G/A]
CTTGGAAGGAGGGCTGAATATTCTATAAGATTAAGCCATTTCGTTGTTTCCAAATGTGTTATGCTGCTAAGAAGAAAACCTCCAGGAAGCCCTTTCGAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.60% 0.19% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 80.30% 19.20% 0.46% 0.00% NA
Aus  269 72.50% 27.10% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.30% 0.39% 0.00% NA
Tropical Japonica  504 57.50% 41.70% 0.79% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419225907 C -> T LOC_Os04g32060.2 upstream_gene_variant ; 1361.0bp to feature; MODIFIER silent_mutation Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0419225907 C -> T LOC_Os04g32060.1 upstream_gene_variant ; 2211.0bp to feature; MODIFIER silent_mutation Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0419225907 C -> T LOC_Os04g32050.1 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0419225907 C -> T LOC_Os04g32050.2 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0419225907 C -> T LOC_Os04g32050-LOC_Os04g32060 intergenic_region ; MODIFIER silent_mutation Average:54.343; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419225907 4.84E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 3.90E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 2.92E-08 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 2.82E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 3.83E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 7.77E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 2.60E-09 NA mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 1.83E-12 3.61E-15 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 9.35E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 6.69E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 7.32E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 2.48E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 1.68E-07 NA mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225907 NA 8.80E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251