Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419225881:

Variant ID: vg0419225881 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19225881
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCACTCTAGCAAGACTCAAGTTTGCTCGAAAGGGCTTCCTGGAGGTTTTCTTCTTAGCAGCATAACACATTTGGAAACAACGAAATGGCTTAATCTT[A/C]
TAGAATATTCAGCCCTCCTTCCAAGCTTGGAGATCACTTTTTGTGAAAGAGGTTCTTCTGCATATGTGCAGAATGAAGGATCCCTTAAAACAAATTGTTT

Reverse complement sequence

AAACAATTTGTTTTAAGGGATCCTTCATTCTGCACATATGCAGAAGAACCTCTTTCACAAAAAGTGATCTCCAAGCTTGGAAGGAGGGCTGAATATTCTA[T/G]
AAGATTAAGCCATTTCGTTGTTTCCAAATGTGTTATGCTGCTAAGAAGAAAACCTCCAGGAAGCCCTTTCGAGCAAACTTGAGTCTTGCTAGAGTGATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	12.00%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	65.20%	34.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	37.70%	62.10%	0.26%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	17.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419225881	A -> C	LOC_Os04g32060.2	upstream_gene_variant ; 1387.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0419225881	A -> C	LOC_Os04g32060.1	upstream_gene_variant ; 2237.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0419225881	A -> C	LOC_Os04g32050.1	downstream_gene_variant ; 502.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0419225881	A -> C	LOC_Os04g32050.2	downstream_gene_variant ; 502.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0419225881	A -> C	LOC_Os04g32050-LOC_Os04g32060	intergenic_region ; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419225881	NA	6.88E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419225881	NA	1.49E-13	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419225881	NA	6.71E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419225881	NA	1.71E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	6.15E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	1.10E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	2.68E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	1.90E-09	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	3.55E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	1.02E-11	2.01E-07	mr1851	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	4.35E-09	4.58E-13	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	3.83E-10	NA	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	3.69E-10	1.69E-17	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	1.11E-06	mr1170_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	1.23E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	3.14E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	7.15E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	2.09E-11	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	2.30E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	5.27E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	2.35E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419225881	NA	8.37E-10	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251