Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419224532:

Variant ID: vg0419224532 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19224532
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCTGCAACTCATACGGCTGTGGCCTCACAGACTGGAACCTTGCGTCCACGTATGGAAAGATTGGCCTTTTTATTTTTGCCTCCTTGGTTGGCCGAAGC[G/A]
GTGGCGTGATTGCTGGCCTAGCAGCTTGCGGTGTTATGATGTCCATCGTATCCACCGCTGCCGATCTCATGCAGGACTTCAGGACTGGTTACCTGACCCT

Reverse complement sequence

AGGGTCAGGTAACCAGTCCTGAAGTCCTGCATGAGATCGGCAGCGGTGGATACGATGGACATCATAACACCGCAAGCTGCTAGGCCAGCAATCACGCCAC[C/T]
GCTTCGGCCAACCAAGGAGGCAAAAATAAAAAGGCCAATCTTTCCATACGTGGACGCAAGGTTCCAGTCTGTGAGGCCACAGCCGTATGAGTTGCAGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.80% 0.23% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 90.80% 8.70% 0.46% 0.00% NA
Aus  269 72.50% 26.80% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 83.70% 15.10% 1.19% 0.00% NA
Japonica Intermediate  241 83.80% 15.80% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 11.50% 2.08% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419224532 G -> A LOC_Os04g32050.1 missense_variant ; p.Gly467Ser; MODERATE nonsynonymous_codon ; G467S Average:85.129; most accessible tissue: Minghui63 flag leaf, score: 91.949 probably damaging 2.076 TOLERATED 0.11
vg0419224532 G -> A LOC_Os04g32050.2 synonymous_variant ; p.Ala439Ala; LOW synonymous_codon Average:85.129; most accessible tissue: Minghui63 flag leaf, score: 91.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419224532 G A 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419224532 NA 4.38E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 1.55E-06 mr1546 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 6.59E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 5.94E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 5.70E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 2.56E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 9.90E-06 mr1283_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 7.20E-07 7.21E-07 mr1367_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 7.00E-06 6.97E-06 mr1387_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 7.85E-07 NA mr1641_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 1.48E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 1.94E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 6.45E-06 NA mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 1.25E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419224532 NA 5.80E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251