\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419218841:

Variant ID: vg0419218841 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19218841
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATGCCGGCGGCACACTCCCGCGTGTACTACTTCGCGCAGGGCCATGCCAACGGCGGTGGGGCCACGGCGGAGCTTGCCGCGGCTACGGGGCCGTGTG[C/T]
CCTCCCGGCGCTCATGCTCTGTCGTATAGAAGTGGTACAGTTCTTGGTCGAACAGGAGTCCGACGAGATCTTGGATGATCTTTGCCTGCTCGGCGGCGGC

Reverse complement sequence

GCCGCCGCCGAGCAGGCAAAGATCATCCAAGATCTCGTCGGACTCCTGTTCGACCAAGAACTGTACCACTTCTATACGACAGAGCATGAGCGCCGGGAGG[G/A]
CACACGGCCCCGTAGCCGCGGCAAGCTCCGCCGTGGCCCCACCGCCGTTGGCATGGCCCTGCGCGAAGTAGTACACGCGGGAGTGTGCCGCCGGCATCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.40% 0.28% 0.13% NA
All Indica  2759 83.80% 15.80% 0.25% 0.18% NA
All Japonica  1512 35.20% 64.60% 0.13% 0.07% NA
Aus  269 72.10% 27.90% 0.00% 0.00% NA
Indica I  595 79.50% 19.80% 0.50% 0.17% NA
Indica II  465 62.60% 37.20% 0.00% 0.22% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 82.20% 16.90% 0.51% 0.38% NA
Temperate Japonica  767 62.50% 37.30% 0.26% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 18.30% 81.30% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 55.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419218841 C -> DEL N N silent_mutation Average:81.35; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0419218841 C -> T LOC_Os04g32050.1 upstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:81.35; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0419218841 C -> T LOC_Os04g32050.2 upstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:81.35; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0419218841 C -> T LOC_Os04g32030-LOC_Os04g32050 intergenic_region ; MODIFIER silent_mutation Average:81.35; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419218841 C T -0.06 -0.03 -0.05 -0.04 -0.07 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419218841 NA 2.06E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419218841 NA 9.19E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419218841 NA 2.69E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 6.70E-09 7.36E-12 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 2.35E-09 5.85E-20 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 7.97E-08 7.97E-08 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 1.31E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 1.23E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 1.54E-27 1.58E-37 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 6.58E-18 3.45E-20 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 9.39E-07 3.52E-11 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 4.76E-28 5.90E-44 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 1.48E-18 2.18E-22 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 6.49E-09 1.79E-16 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 2.30E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 2.45E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 1.79E-08 1.28E-22 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 1.49E-06 2.01E-07 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 7.13E-11 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 2.95E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 5.67E-11 7.53E-20 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 6.10E-06 NA mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 5.37E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 7.81E-10 5.83E-23 mr1864_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 6.23E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 1.17E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419218841 NA 1.83E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251