\
| Variant ID: vg0419118424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19118424 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 250. )
GAGGAGGGGACGCTGACATCTAGGCCCCACATGCTAATTCAGTCGGTTAGATCAGGTCAACAAGCCACGCCAGCGAATATCGTCCTCAAAACACTCGAGG[A/G]
AGTTGTTTTATAACAGTTTTAATAGTTGAGGGGTCAATATATCCTACTTTGGGTTAATTGATACAAATCAGGTTAACCTATGGTTGAAGGAGTCAAATTG
CAATTTGACTCCTTCAACCATAGGTTAACCTGATTTGTATCAATTAACCCAAAGTAGGATATATTGACCCCTCAACTATTAAAACTGTTATAAAACAACT[T/C]
CCTCGAGTGTTTTGAGGACGATATTCGCTGGCGTGGCTTGTTGACCTGATCTAACCGACTGAATTAGCATGTGGGGCCTAGATGTCAGCGTCCCCTCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.50% | 0.25% | 0.15% | NA |
| All Indica | 2759 | 48.10% | 51.20% | 0.43% | 0.22% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.00% | 57.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 43.40% | 56.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 82.60% | 17.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 31.10% | 68.10% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 51.10% | 48.00% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419118424 | A -> DEL | N | N | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0419118424 | A -> G | LOC_Os04g31910.1 | upstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0419118424 | A -> G | LOC_Os04g31924.1 | upstream_gene_variant ; 4140.0bp to feature; MODIFIER | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0419118424 | A -> G | LOC_Os04g31924.2 | upstream_gene_variant ; 4140.0bp to feature; MODIFIER | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0419118424 | A -> G | LOC_Os04g31900.1 | downstream_gene_variant ; 4854.0bp to feature; MODIFIER | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0419118424 | A -> G | LOC_Os04g31910-LOC_Os04g31924 | intergenic_region ; MODIFIER | silent_mutation | Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419118424 | NA | 2.31E-07 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | NA | 1.76E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | NA | 8.43E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | NA | 3.46E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | 2.13E-07 | 2.13E-07 | mr1405_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | NA | 1.48E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419118424 | NA | 6.63E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |