Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419118424:

Variant ID: vg0419118424 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19118424
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGAGGGGACGCTGACATCTAGGCCCCACATGCTAATTCAGTCGGTTAGATCAGGTCAACAAGCCACGCCAGCGAATATCGTCCTCAAAACACTCGAGG[A/G]
AGTTGTTTTATAACAGTTTTAATAGTTGAGGGGTCAATATATCCTACTTTGGGTTAATTGATACAAATCAGGTTAACCTATGGTTGAAGGAGTCAAATTG

Reverse complement sequence

CAATTTGACTCCTTCAACCATAGGTTAACCTGATTTGTATCAATTAACCCAAAGTAGGATATATTGACCCCTCAACTATTAAAACTGTTATAAAACAACT[T/C]
CCTCGAGTGTTTTGAGGACGATATTCGCTGGCGTGGCTTGTTGACCTGATCTAACCGACTGAATTAGCATGTGGGGCCTAGATGTCAGCGTCCCCTCCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.50%	0.25%	0.15%	NA
All Indica	2759	48.10%	51.20%	0.43%	0.22%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	42.00%	57.60%	0.00%	0.37%	NA
Indica I	595	43.40%	56.10%	0.50%	0.00%	NA
Indica II	465	82.60%	17.20%	0.22%	0.00%	NA
Indica III	913	31.10%	68.10%	0.44%	0.33%	NA
Indica Intermediate	786	51.10%	48.00%	0.51%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419118424	A -> DEL	N	N	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0419118424	A -> G	LOC_Os04g31910.1	upstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0419118424	A -> G	LOC_Os04g31924.1	upstream_gene_variant ; 4140.0bp to feature; MODIFIER	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0419118424	A -> G	LOC_Os04g31924.2	upstream_gene_variant ; 4140.0bp to feature; MODIFIER	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0419118424	A -> G	LOC_Os04g31900.1	downstream_gene_variant ; 4854.0bp to feature; MODIFIER	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0419118424	A -> G	LOC_Os04g31910-LOC_Os04g31924	intergenic_region ; MODIFIER	silent_mutation	Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419118424	NA	2.31E-07	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	NA	1.76E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	NA	8.43E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	NA	3.46E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	2.13E-07	2.13E-07	mr1405_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	NA	1.48E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424	NA	6.63E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251