\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419118424:

Variant ID: vg0419118424 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19118424
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAGGGGACGCTGACATCTAGGCCCCACATGCTAATTCAGTCGGTTAGATCAGGTCAACAAGCCACGCCAGCGAATATCGTCCTCAAAACACTCGAGG[A/G]
AGTTGTTTTATAACAGTTTTAATAGTTGAGGGGTCAATATATCCTACTTTGGGTTAATTGATACAAATCAGGTTAACCTATGGTTGAAGGAGTCAAATTG

Reverse complement sequence

CAATTTGACTCCTTCAACCATAGGTTAACCTGATTTGTATCAATTAACCCAAAGTAGGATATATTGACCCCTCAACTATTAAAACTGTTATAAAACAACT[T/C]
CCTCGAGTGTTTTGAGGACGATATTCGCTGGCGTGGCTTGTTGACCTGATCTAACCGACTGAATTAGCATGTGGGGCCTAGATGTCAGCGTCCCCTCCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.50% 0.25% 0.15% NA
All Indica  2759 48.10% 51.20% 0.43% 0.22% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 42.00% 57.60% 0.00% 0.37% NA
Indica I  595 43.40% 56.10% 0.50% 0.00% NA
Indica II  465 82.60% 17.20% 0.22% 0.00% NA
Indica III  913 31.10% 68.10% 0.44% 0.33% NA
Indica Intermediate  786 51.10% 48.00% 0.51% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419118424 A -> DEL N N silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0419118424 A -> G LOC_Os04g31910.1 upstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0419118424 A -> G LOC_Os04g31924.1 upstream_gene_variant ; 4140.0bp to feature; MODIFIER silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0419118424 A -> G LOC_Os04g31924.2 upstream_gene_variant ; 4140.0bp to feature; MODIFIER silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0419118424 A -> G LOC_Os04g31900.1 downstream_gene_variant ; 4854.0bp to feature; MODIFIER silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0419118424 A -> G LOC_Os04g31910-LOC_Os04g31924 intergenic_region ; MODIFIER silent_mutation Average:52.781; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419118424 NA 2.31E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 NA 1.76E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 NA 8.43E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 NA 3.46E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 2.13E-07 2.13E-07 mr1405_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 NA 1.48E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419118424 NA 6.63E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251