\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419067732:

Variant ID: vg0419067732 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19067732
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCCGGGCTGCCGCGCCGATTCATGCCGGAATCTGCCACCGGCCGGGAGGTGGTCGCGCTGGGTGAGGGACGCCCGGCGCCACACTACCCGGGGCGGTC[C/T]
GTCTTCTTCCTTTCTTTCGCAATGGCAGGACTGGTCCCGCCATTCTCTTCTTTCTTCATGGATGTTCTGGAGCTTTACGATCTCCAGATGGCGCACCTCA

Reverse complement sequence

TGAGGTGCGCCATCTGGAGATCGTAAAGCTCCAGAACATCCATGAAGAAAGAAGAGAATGGCGGGACCAGTCCTGCCATTGCGAAAGAAAGGAAGAAGAC[G/A]
GACCGCCCCGGGTAGTGTGGCGCCGGGCGTCCCTCACCCAGCGCGACCACCTCCCGGCCGGTGGCAGATTCCGGCATGAATCGGCGCGGCAGCCCGGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 2.70% 20.48% 6.39% NA
All Indica  2759 60.80% 0.00% 30.77% 8.45% NA
All Japonica  1512 85.40% 8.10% 2.45% 4.03% NA
Aus  269 70.30% 0.00% 27.88% 1.86% NA
Indica I  595 48.40% 0.00% 26.89% 24.71% NA
Indica II  465 86.50% 0.00% 10.97% 2.58% NA
Indica III  913 55.40% 0.00% 43.15% 1.42% NA
Indica Intermediate  786 61.20% 0.00% 31.04% 7.76% NA
Temperate Japonica  767 75.50% 12.30% 4.43% 7.82% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 11.60% 0.83% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 87.80% 3.30% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419067732 C -> DEL LOC_Os04g31850.1 N frameshift_variant Average:63.48; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0419067732 C -> T LOC_Os04g31850.1 synonymous_variant ; p.Ser56Ser; LOW synonymous_codon Average:63.48; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419067732 C T 0.0 -0.01 0.0 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419067732 NA 2.12E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419067732 NA 1.47E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419067732 NA 6.61E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419067732 NA 2.06E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419067732 NA 6.31E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419067732 3.86E-06 3.86E-06 mr1950_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251