Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418975362:

Variant ID: vg0418975362 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 18975362
Reference Allele: AAlternative Allele: G,ACGAGGT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAAAAGAAAAAGGTAACCCTCGCTATAACCAGTAGTAGCGATGGCTATGTCGAGAATGGCTAGTTTTGTGCATACTTTGATCCTGTTCGACACGCGTC[A/G,ACGAGGT]
ACGAGGTTCACAGCATAAGTAAACTACTAGAGTAGCCATAAAATTTTCCAGAGCCCGAACAAATCTAACTACGTGTACGTAGGCCTATACCCTGTCGACG

Reverse complement sequence

CGTCGACAGGGTATAGGCCTACGTACACGTAGTTAGATTTGTTCGGGCTCTGGAAAATTTTATGGCTACTCTAGTAGTTTACTTATGCTGTGAACCTCGT[T/C,ACCTCGT]
GACGCGTGTCGAACAGGATCAAAGTATGCACAAAACTAGCCATTCTCGACATAGCCATCGCTACTACTGGTTATAGCGAGGGTTACCTTTTTCTTTTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 48.50% 2.31% 0.00% ACGAGGT: 0.06%
All Indica  2759 44.40% 55.10% 0.40% 0.00% ACGAGGT: 0.11%
All Japonica  1512 62.40% 31.50% 6.15% 0.00% NA
Aus  269 1.90% 97.40% 0.74% 0.00% NA
Indica I  595 36.60% 62.40% 1.01% 0.00% NA
Indica II  465 82.40% 17.60% 0.00% 0.00% NA
Indica III  913 29.10% 70.50% 0.11% 0.00% ACGAGGT: 0.22%
Indica Intermediate  786 45.70% 53.70% 0.51% 0.00% ACGAGGT: 0.13%
Temperate Japonica  767 48.10% 42.00% 9.91% 0.00% NA
Tropical Japonica  504 81.70% 16.50% 1.79% 0.00% NA
Japonica Intermediate  241 67.20% 29.50% 3.32% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418975362 A -> ACGAGGT LOC_Os04g31670.1 upstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0418975362 A -> ACGAGGT LOC_Os04g31680.1 downstream_gene_variant ; 2740.0bp to feature; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0418975362 A -> ACGAGGT LOC_Os04g31660-LOC_Os04g31670 intergenic_region ; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0418975362 A -> G LOC_Os04g31670.1 upstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0418975362 A -> G LOC_Os04g31680.1 downstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0418975362 A -> G LOC_Os04g31660-LOC_Os04g31670 intergenic_region ; MODIFIER silent_mutation Average:85.971; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418975362 A ACGAG* -0.09 0.19 0.07 0.09 -0.04 -0.24
vg0418975362 A G -0.14 0.01 0.02 0.0 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418975362 5.82E-07 5.82E-07 mr1448_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251