\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418857060:

Variant ID: vg0418857060 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18857060
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTTAATACAATAAAGTGCAACAAAAAATATAAAAAACTGAAATATCAGACGGTTGTTGCAAAATGTTTCACTGAAAAATGTTCAGATGTTTCATCAAC[C/T]
AGGGAAAAATGTTTCATCGCATCGACGAAAGTGTTTCAACCGAATTCAATCGAAACATATCGATTGCAACATGAAAAATCAATATGTGCAACATCGAATC

Reverse complement sequence

GATTCGATGTTGCACATATTGATTTTTCATGTTGCAATCGATATGTTTCGATTGAATTCGGTTGAAACACTTTCGTCGATGCGATGAAACATTTTTCCCT[G/A]
GTTGATGAAACATCTGAACATTTTTCAGTGAAACATTTTGCAACAACCGTCTGATATTTCAGTTTTTTATATTTTTTGTTGCACTTTATTGTATTAAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.30% 0.00% 0.00% NA
All Indica  2759 90.90% 9.10% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 73.40% 26.60% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418857060 C -> T LOC_Os04g31540.1 upstream_gene_variant ; 4972.0bp to feature; MODIFIER silent_mutation Average:29.916; most accessible tissue: Callus, score: 57.87 N N N N
vg0418857060 C -> T LOC_Os04g31530.1 downstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:29.916; most accessible tissue: Callus, score: 57.87 N N N N
vg0418857060 C -> T LOC_Os04g31524-LOC_Os04g31530 intergenic_region ; MODIFIER silent_mutation Average:29.916; most accessible tissue: Callus, score: 57.87 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418857060 NA 3.41E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 5.20E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 3.61E-08 7.74E-11 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 1.57E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 3.52E-07 1.10E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 4.64E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 1.88E-08 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 1.09E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418857060 NA 1.99E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251