\
| Variant ID: vg0418857060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18857060 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 124. )
ACCTTAATACAATAAAGTGCAACAAAAAATATAAAAAACTGAAATATCAGACGGTTGTTGCAAAATGTTTCACTGAAAAATGTTCAGATGTTTCATCAAC[C/T]
AGGGAAAAATGTTTCATCGCATCGACGAAAGTGTTTCAACCGAATTCAATCGAAACATATCGATTGCAACATGAAAAATCAATATGTGCAACATCGAATC
GATTCGATGTTGCACATATTGATTTTTCATGTTGCAATCGATATGTTTCGATTGAATTCGGTTGAAACACTTTCGTCGATGCGATGAAACATTTTTCCCT[G/A]
GTTGATGAAACATCTGAACATTTTTCAGTGAAACATTTTGCAACAACCGTCTGATATTTCAGTTTTTTATATTTTTTGTTGCACTTTATTGTATTAAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418857060 | C -> T | LOC_Os04g31540.1 | upstream_gene_variant ; 4972.0bp to feature; MODIFIER | silent_mutation | Average:29.916; most accessible tissue: Callus, score: 57.87 | N | N | N | N |
| vg0418857060 | C -> T | LOC_Os04g31530.1 | downstream_gene_variant ; 2358.0bp to feature; MODIFIER | silent_mutation | Average:29.916; most accessible tissue: Callus, score: 57.87 | N | N | N | N |
| vg0418857060 | C -> T | LOC_Os04g31524-LOC_Os04g31530 | intergenic_region ; MODIFIER | silent_mutation | Average:29.916; most accessible tissue: Callus, score: 57.87 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418857060 | NA | 3.41E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 5.20E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | 3.61E-08 | 7.74E-11 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 1.57E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | 3.52E-07 | 1.10E-10 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 4.64E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 1.88E-08 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 1.09E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418857060 | NA | 1.99E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |