\
| Variant ID: vg0418822416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18822416 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 99. )
TTCTTTTAGCTAATCGATCTCTCCTATTTTCTAGCTAATAATTAATATAAAAAAATTAATTAGTATTTATTATTTATACCTATATTATAAGAAGTATATG[G/A]
TACATGGATCCATATTCTAACAGTCTACATGCTATAAACAGATTTGCAAATATTAGAGAACAATTTAATATGCGGATTATCCTATTATACACTTCAAAAG
CTTTTGAAGTGTATAATAGGATAATCCGCATATTAAATTGTTCTCTAATATTTGCAAATCTGTTTATAGCATGTAGACTGTTAGAATATGGATCCATGTA[C/T]
CATATACTTCTTATAATATAGGTATAAATAATAAATACTAATTAATTTTTTTATATTAATTATTAGCTAGAAAATAGGAGAGATCGATTAGCTAAAAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 5.80% | 0.80% | 23.87% | NA |
| All Indica | 2759 | 48.50% | 9.60% | 1.34% | 40.49% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.30% | 27.10% | 0.50% | 2.18% | NA |
| Indica II | 465 | 52.30% | 2.20% | 2.37% | 43.23% | NA |
| Indica III | 913 | 33.70% | 3.90% | 0.66% | 61.66% | NA |
| Indica Intermediate | 786 | 47.10% | 7.50% | 2.16% | 43.26% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418822416 | G -> DEL | N | N | silent_mutation | Average:18.663; most accessible tissue: Callus, score: 53.233 | N | N | N | N |
| vg0418822416 | G -> A | LOC_Os04g31460.1 | upstream_gene_variant ; 1385.0bp to feature; MODIFIER | silent_mutation | Average:18.663; most accessible tissue: Callus, score: 53.233 | N | N | N | N |
| vg0418822416 | G -> A | LOC_Os04g31484.1 | upstream_gene_variant ; 4670.0bp to feature; MODIFIER | silent_mutation | Average:18.663; most accessible tissue: Callus, score: 53.233 | N | N | N | N |
| vg0418822416 | G -> A | LOC_Os04g31470.1 | downstream_gene_variant ; 3473.0bp to feature; MODIFIER | silent_mutation | Average:18.663; most accessible tissue: Callus, score: 53.233 | N | N | N | N |
| vg0418822416 | G -> A | LOC_Os04g31440-LOC_Os04g31460 | intergenic_region ; MODIFIER | silent_mutation | Average:18.663; most accessible tissue: Callus, score: 53.233 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418822416 | NA | 3.60E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 5.20E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 8.26E-09 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 1.57E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 3.60E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 4.64E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 3.76E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 1.09E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418822416 | NA | 1.99E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |