Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418822416:

Variant ID: vg0418822416 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18822416
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTTTTAGCTAATCGATCTCTCCTATTTTCTAGCTAATAATTAATATAAAAAAATTAATTAGTATTTATTATTTATACCTATATTATAAGAAGTATATG[G/A]
TACATGGATCCATATTCTAACAGTCTACATGCTATAAACAGATTTGCAAATATTAGAGAACAATTTAATATGCGGATTATCCTATTATACACTTCAAAAG

Reverse complement sequence

CTTTTGAAGTGTATAATAGGATAATCCGCATATTAAATTGTTCTCTAATATTTGCAAATCTGTTTATAGCATGTAGACTGTTAGAATATGGATCCATGTA[C/T]
CATATACTTCTTATAATATAGGTATAAATAATAAATACTAATTAATTTTTTTATATTAATTATTAGCTAGAAAATAGGAGAGATCGATTAGCTAAAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	5.80%	0.80%	23.87%	NA
All Indica	2759	48.50%	9.60%	1.34%	40.49%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.07%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	70.30%	27.10%	0.50%	2.18%	NA
Indica II	465	52.30%	2.20%	2.37%	43.23%	NA
Indica III	913	33.70%	3.90%	0.66%	61.66%	NA
Indica Intermediate	786	47.10%	7.50%	2.16%	43.26%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	0.00%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418822416	G -> DEL	N	N	silent_mutation	Average:18.663; most accessible tissue: Callus, score: 53.233	N	N	N	N
vg0418822416	G -> A	LOC_Os04g31460.1	upstream_gene_variant ; 1385.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Callus, score: 53.233	N	N	N	N
vg0418822416	G -> A	LOC_Os04g31484.1	upstream_gene_variant ; 4670.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Callus, score: 53.233	N	N	N	N
vg0418822416	G -> A	LOC_Os04g31470.1	downstream_gene_variant ; 3473.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Callus, score: 53.233	N	N	N	N
vg0418822416	G -> A	LOC_Os04g31440-LOC_Os04g31460	intergenic_region ; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Callus, score: 53.233	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418822416	NA	3.60E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	5.20E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	8.26E-09	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	1.57E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	3.60E-09	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	4.64E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	3.76E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	1.09E-06	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416	NA	1.99E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251