\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418822416:

Variant ID: vg0418822416 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18822416
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTTAGCTAATCGATCTCTCCTATTTTCTAGCTAATAATTAATATAAAAAAATTAATTAGTATTTATTATTTATACCTATATTATAAGAAGTATATG[G/A]
TACATGGATCCATATTCTAACAGTCTACATGCTATAAACAGATTTGCAAATATTAGAGAACAATTTAATATGCGGATTATCCTATTATACACTTCAAAAG

Reverse complement sequence

CTTTTGAAGTGTATAATAGGATAATCCGCATATTAAATTGTTCTCTAATATTTGCAAATCTGTTTATAGCATGTAGACTGTTAGAATATGGATCCATGTA[C/T]
CATATACTTCTTATAATATAGGTATAAATAATAAATACTAATTAATTTTTTTATATTAATTATTAGCTAGAAAATAGGAGAGATCGATTAGCTAAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 5.80% 0.80% 23.87% NA
All Indica  2759 48.50% 9.60% 1.34% 40.49% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.07% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 70.30% 27.10% 0.50% 2.18% NA
Indica II  465 52.30% 2.20% 2.37% 43.23% NA
Indica III  913 33.70% 3.90% 0.66% 61.66% NA
Indica Intermediate  786 47.10% 7.50% 2.16% 43.26% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 0.00% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418822416 G -> DEL N N silent_mutation Average:18.663; most accessible tissue: Callus, score: 53.233 N N N N
vg0418822416 G -> A LOC_Os04g31460.1 upstream_gene_variant ; 1385.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Callus, score: 53.233 N N N N
vg0418822416 G -> A LOC_Os04g31484.1 upstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Callus, score: 53.233 N N N N
vg0418822416 G -> A LOC_Os04g31470.1 downstream_gene_variant ; 3473.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Callus, score: 53.233 N N N N
vg0418822416 G -> A LOC_Os04g31440-LOC_Os04g31460 intergenic_region ; MODIFIER silent_mutation Average:18.663; most accessible tissue: Callus, score: 53.233 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418822416 NA 3.60E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 5.20E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 8.26E-09 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 1.57E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 3.60E-09 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 4.64E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 3.76E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 1.09E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418822416 NA 1.99E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251