\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418804402:

Variant ID: vg0418804402 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18804402
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGACCAAAATTATGTCAATCCAAAAATAAAGTGATGTTACCTTGCAACACAATCATCATCTCAAAATTCAAGGGGAGTATGCCGCCAAAATACCTACGAA[C/T]
GAGAAGATGTCGAGGCCTCCGTGTTGGGGTTAGAAATAAGAAATTTTGGAATCCAACACTGAGTCGCACGACCAGTAGAACCAGTAGGTACATACGCACT

Reverse complement sequence

AGTGCGTATGTACCTACTGGTTCTACTGGTCGTGCGACTCAGTGTTGGATTCCAAAATTTCTTATTTCTAACCCCAACACGGAGGCCTCGACATCTTCTC[G/A]
TTCGTAGGTATTTTGGCGGCATACTCCCCTTGAATTTTGAGATGATGATTGTGTTGCAAGGTAACATCACTTTATTTTTGGATTGACATAATTTTGGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 5.90% 3.32% 20.14% NA
All Indica  2759 51.10% 9.40% 5.33% 34.18% NA
All Japonica  1512 99.30% 0.10% 0.53% 0.07% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 71.10% 26.20% 0.84% 1.85% NA
Indica II  465 56.60% 2.20% 5.16% 36.13% NA
Indica III  913 35.30% 3.80% 7.56% 53.34% NA
Indica Intermediate  786 51.00% 7.50% 6.23% 35.24% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 97.10% 0.40% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 0.00% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418804402 C -> DEL N N silent_mutation Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0418804402 C -> T LOC_Os04g31430.1 downstream_gene_variant ; 2874.0bp to feature; MODIFIER silent_mutation Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0418804402 C -> T LOC_Os04g31440.1 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0418804402 C -> T LOC_Os04g31430-LOC_Os04g31440 intergenic_region ; MODIFIER silent_mutation Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418804402 7.57E-07 1.22E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 2.33E-06 3.82E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 1.57E-09 1.11E-12 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 1.58E-08 1.22E-10 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 2.85E-07 3.11E-11 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 1.24E-06 1.02E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 NA 1.07E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 NA 5.04E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402 NA 5.16E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251