\
| Variant ID: vg0418804402 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18804402 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )
AGACCAAAATTATGTCAATCCAAAAATAAAGTGATGTTACCTTGCAACACAATCATCATCTCAAAATTCAAGGGGAGTATGCCGCCAAAATACCTACGAA[C/T]
GAGAAGATGTCGAGGCCTCCGTGTTGGGGTTAGAAATAAGAAATTTTGGAATCCAACACTGAGTCGCACGACCAGTAGAACCAGTAGGTACATACGCACT
AGTGCGTATGTACCTACTGGTTCTACTGGTCGTGCGACTCAGTGTTGGATTCCAAAATTTCTTATTTCTAACCCCAACACGGAGGCCTCGACATCTTCTC[G/A]
TTCGTAGGTATTTTGGCGGCATACTCCCCTTGAATTTTGAGATGATGATTGTGTTGCAAGGTAACATCACTTTATTTTTGGATTGACATAATTTTGGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 5.90% | 3.32% | 20.14% | NA |
| All Indica | 2759 | 51.10% | 9.40% | 5.33% | 34.18% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.53% | 0.07% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.10% | 26.20% | 0.84% | 1.85% | NA |
| Indica II | 465 | 56.60% | 2.20% | 5.16% | 36.13% | NA |
| Indica III | 913 | 35.30% | 3.80% | 7.56% | 53.34% | NA |
| Indica Intermediate | 786 | 51.00% | 7.50% | 6.23% | 35.24% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418804402 | C -> DEL | N | N | silent_mutation | Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0418804402 | C -> T | LOC_Os04g31430.1 | downstream_gene_variant ; 2874.0bp to feature; MODIFIER | silent_mutation | Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0418804402 | C -> T | LOC_Os04g31440.1 | downstream_gene_variant ; 1274.0bp to feature; MODIFIER | silent_mutation | Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0418804402 | C -> T | LOC_Os04g31430-LOC_Os04g31440 | intergenic_region ; MODIFIER | silent_mutation | Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418804402 | 7.57E-07 | 1.22E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | 2.33E-06 | 3.82E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | 1.57E-09 | 1.11E-12 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | 1.58E-08 | 1.22E-10 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | 2.85E-07 | 3.11E-11 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | 1.24E-06 | 1.02E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | NA | 1.07E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | NA | 5.04E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804402 | NA | 5.16E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |