\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418804144:

Variant ID: vg0418804144 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18804144
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGCTTGATAAAACCATGAGGTACAAACTCCTCCTCAAATCATGCCAAAAGAAAGTCATAAAAAGCACTAACTCCCCCTCAAAATAACCTCCAATTCT[T/C]
CCCGAACAAAAATCAAGAAGAAATCAAAGATTTTGAAAAAGACATCCAATTACCAACGATATCACCAAAATTTTCAAGAATTGACATACATCAATAGTAT

Reverse complement sequence

ATACTATTGATGTATGTCAATTCTTGAAAATTTTGGTGATATCGTTGGTAATTGGATGTCTTTTTCAAAATCTTTGATTTCTTCTTGATTTTTGTTCGGG[A/G]
AGAATTGGAGGTTATTTTGAGGGGGAGTTAGTGCTTTTTATGACTTTCTTTTGGCATGATTTGAGGAGGAGTTTGTACCTCATGGTTTTATCAAGCAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 28.50% 4.02% 17.88% NA
All Indica  2759 20.90% 42.10% 6.63% 30.34% NA
All Japonica  1512 99.10% 0.70% 0.13% 0.07% NA
Aus  269 39.80% 60.20% 0.00% 0.00% NA
Indica I  595 26.20% 70.90% 1.01% 1.85% NA
Indica II  465 44.50% 15.10% 7.74% 32.69% NA
Indica III  913 3.40% 42.30% 9.31% 45.02% NA
Indica Intermediate  786 23.40% 36.00% 7.12% 33.46% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 78.90% 7.80% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418804144 T -> C LOC_Os04g31430.1 downstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N
vg0418804144 T -> C LOC_Os04g31440.1 downstream_gene_variant ; 1532.0bp to feature; MODIFIER silent_mutation Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N
vg0418804144 T -> C LOC_Os04g31430-LOC_Os04g31440 intergenic_region ; MODIFIER silent_mutation Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N
vg0418804144 T -> DEL N N silent_mutation Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418804144 1.08E-06 5.20E-15 mr1521 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 1.25E-06 1.25E-06 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 NA 4.81E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 NA 7.65E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 4.66E-06 1.45E-10 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 NA 2.11E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144 NA 8.32E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251