Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418804144:

Variant ID: vg0418804144 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18804144
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGCTTGATAAAACCATGAGGTACAAACTCCTCCTCAAATCATGCCAAAAGAAAGTCATAAAAAGCACTAACTCCCCCTCAAAATAACCTCCAATTCT[T/C]
CCCGAACAAAAATCAAGAAGAAATCAAAGATTTTGAAAAAGACATCCAATTACCAACGATATCACCAAAATTTTCAAGAATTGACATACATCAATAGTAT

Reverse complement sequence

ATACTATTGATGTATGTCAATTCTTGAAAATTTTGGTGATATCGTTGGTAATTGGATGTCTTTTTCAAAATCTTTGATTTCTTCTTGATTTTTGTTCGGG[A/G]
AGAATTGGAGGTTATTTTGAGGGGGAGTTAGTGCTTTTTATGACTTTCTTTTGGCATGATTTGAGGAGGAGTTTGTACCTCATGGTTTTATCAAGCAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	28.50%	4.02%	17.88%	NA
All Indica	2759	20.90%	42.10%	6.63%	30.34%	NA
All Japonica	1512	99.10%	0.70%	0.13%	0.07%	NA
Aus	269	39.80%	60.20%	0.00%	0.00%	NA
Indica I	595	26.20%	70.90%	1.01%	1.85%	NA
Indica II	465	44.50%	15.10%	7.74%	32.69%	NA
Indica III	913	3.40%	42.30%	9.31%	45.02%	NA
Indica Intermediate	786	23.40%	36.00%	7.12%	33.46%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.00%	0.20%	NA
Japonica Intermediate	241	96.70%	2.50%	0.83%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	78.90%	7.80%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418804144	T -> C	LOC_Os04g31430.1	downstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95	N	N	N	N
vg0418804144	T -> C	LOC_Os04g31440.1	downstream_gene_variant ; 1532.0bp to feature; MODIFIER	silent_mutation	Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95	N	N	N	N
vg0418804144	T -> C	LOC_Os04g31430-LOC_Os04g31440	intergenic_region ; MODIFIER	silent_mutation	Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95	N	N	N	N
vg0418804144	T -> DEL	N	N	silent_mutation	Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418804144	1.08E-06	5.20E-15	mr1521	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	1.25E-06	1.25E-06	mr1521	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	NA	4.81E-06	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	NA	7.65E-12	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	4.66E-06	1.45E-10	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	NA	2.11E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804144	NA	8.32E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251