\
| Variant ID: vg0418804144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18804144 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 93. )
TGTTGCTTGATAAAACCATGAGGTACAAACTCCTCCTCAAATCATGCCAAAAGAAAGTCATAAAAAGCACTAACTCCCCCTCAAAATAACCTCCAATTCT[T/C]
CCCGAACAAAAATCAAGAAGAAATCAAAGATTTTGAAAAAGACATCCAATTACCAACGATATCACCAAAATTTTCAAGAATTGACATACATCAATAGTAT
ATACTATTGATGTATGTCAATTCTTGAAAATTTTGGTGATATCGTTGGTAATTGGATGTCTTTTTCAAAATCTTTGATTTCTTCTTGATTTTTGTTCGGG[A/G]
AGAATTGGAGGTTATTTTGAGGGGGAGTTAGTGCTTTTTATGACTTTCTTTTGGCATGATTTGAGGAGGAGTTTGTACCTCATGGTTTTATCAAGCAACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 28.50% | 4.02% | 17.88% | NA |
| All Indica | 2759 | 20.90% | 42.10% | 6.63% | 30.34% | NA |
| All Japonica | 1512 | 99.10% | 0.70% | 0.13% | 0.07% | NA |
| Aus | 269 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.20% | 70.90% | 1.01% | 1.85% | NA |
| Indica II | 465 | 44.50% | 15.10% | 7.74% | 32.69% | NA |
| Indica III | 913 | 3.40% | 42.30% | 9.31% | 45.02% | NA |
| Indica Intermediate | 786 | 23.40% | 36.00% | 7.12% | 33.46% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 7.80% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418804144 | T -> C | LOC_Os04g31430.1 | downstream_gene_variant ; 2616.0bp to feature; MODIFIER | silent_mutation | Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 | N | N | N | N |
| vg0418804144 | T -> C | LOC_Os04g31440.1 | downstream_gene_variant ; 1532.0bp to feature; MODIFIER | silent_mutation | Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 | N | N | N | N |
| vg0418804144 | T -> C | LOC_Os04g31430-LOC_Os04g31440 | intergenic_region ; MODIFIER | silent_mutation | Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 | N | N | N | N |
| vg0418804144 | T -> DEL | N | N | silent_mutation | Average:10.975; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418804144 | 1.08E-06 | 5.20E-15 | mr1521 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | 1.25E-06 | 1.25E-06 | mr1521 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | NA | 4.81E-06 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | NA | 7.65E-12 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | 4.66E-06 | 1.45E-10 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | NA | 2.11E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418804144 | NA | 8.32E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |