\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418802751:

Variant ID: vg0418802751 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18802751
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AAACAAACAAAGAAACCATATTTCGAGACCAAGCTATCTCCAACTTGACTCATTGTTAGCAAACAACAGTATTACATACGTATAGTATCCATCTAGAAGC[T/C]
ATAACCATGAAACAATCACGGATATCCAAAGAAACAACCCAAAACCGAAACCGACACAGCGTCAGCCGGTCAAACCGTGGGCAAGCCGGTCTGACCGCTC

Reverse complement sequence

GAGCGGTCAGACCGGCTTGCCCACGGTTTGACCGGCTGACGCTGTGTCGGTTTCGGTTTTGGGTTGTTTCTTTGGATATCCGTGATTGTTTCATGGTTAT[A/G]
GCTTCTAGATGGATACTATACGTATGTAATACTGTTGTTTGCTAACAATGAGTCAAGTTGGAGATAGCTTGGTCTCGAAATATGGTTTCTTTGTTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 26.30% 0.72% 23.68% NA
All Indica  2759 20.30% 38.60% 0.83% 40.20% NA
All Japonica  1512 99.10% 0.30% 0.53% 0.07% NA
Aus  269 39.80% 59.50% 0.74% 0.00% NA
Indica I  595 24.90% 72.80% 0.34% 2.02% NA
Indica II  465 44.50% 11.60% 0.86% 43.01% NA
Indica III  913 3.00% 35.40% 0.22% 61.45% NA
Indica Intermediate  786 22.80% 32.60% 1.91% 42.75% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.20% 0.20% NA
Japonica Intermediate  241 96.70% 0.80% 2.49% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 80.00% 8.90% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418802751 T -> C LOC_Os04g31430.1 downstream_gene_variant ; 1223.0bp to feature; MODIFIER silent_mutation Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg0418802751 T -> C LOC_Os04g31440.1 downstream_gene_variant ; 2925.0bp to feature; MODIFIER silent_mutation Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg0418802751 T -> C LOC_Os04g31430-LOC_Os04g31440 intergenic_region ; MODIFIER silent_mutation Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg0418802751 T -> DEL N N silent_mutation Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418802751 7.65E-06 2.50E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751 1.26E-06 1.26E-06 mr1521 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751 NA 4.40E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751 NA 1.46E-09 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751 NA 9.11E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251