Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418802751:

Variant ID: vg0418802751 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18802751
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AAACAAACAAAGAAACCATATTTCGAGACCAAGCTATCTCCAACTTGACTCATTGTTAGCAAACAACAGTATTACATACGTATAGTATCCATCTAGAAGC[T/C]
ATAACCATGAAACAATCACGGATATCCAAAGAAACAACCCAAAACCGAAACCGACACAGCGTCAGCCGGTCAAACCGTGGGCAAGCCGGTCTGACCGCTC

Reverse complement sequence

GAGCGGTCAGACCGGCTTGCCCACGGTTTGACCGGCTGACGCTGTGTCGGTTTCGGTTTTGGGTTGTTTCTTTGGATATCCGTGATTGTTTCATGGTTAT[A/G]
GCTTCTAGATGGATACTATACGTATGTAATACTGTTGTTTGCTAACAATGAGTCAAGTTGGAGATAGCTTGGTCTCGAAATATGGTTTCTTTGTTTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	26.30%	0.72%	23.68%	NA
All Indica	2759	20.30%	38.60%	0.83%	40.20%	NA
All Japonica	1512	99.10%	0.30%	0.53%	0.07%	NA
Aus	269	39.80%	59.50%	0.74%	0.00%	NA
Indica I	595	24.90%	72.80%	0.34%	2.02%	NA
Indica II	465	44.50%	11.60%	0.86%	43.01%	NA
Indica III	913	3.00%	35.40%	0.22%	61.45%	NA
Indica Intermediate	786	22.80%	32.60%	1.91%	42.75%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.20%	0.20%	NA
Japonica Intermediate	241	96.70%	0.80%	2.49%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	8.90%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418802751	T -> C	LOC_Os04g31430.1	downstream_gene_variant ; 1223.0bp to feature; MODIFIER	silent_mutation	Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0418802751	T -> C	LOC_Os04g31440.1	downstream_gene_variant ; 2925.0bp to feature; MODIFIER	silent_mutation	Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0418802751	T -> C	LOC_Os04g31430-LOC_Os04g31440	intergenic_region ; MODIFIER	silent_mutation	Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0418802751	T -> DEL	N	N	silent_mutation	Average:22.817; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418802751	7.65E-06	2.50E-13	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751	1.26E-06	1.26E-06	mr1521	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751	NA	4.40E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751	NA	1.46E-09	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418802751	NA	9.11E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251