\
| Variant ID: vg0418797097 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18797097 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCGTAACTCAAAACTCAACTCAATTGCTCTCTAAAGCGATACCGGGAAGCCTCA[C/T]
GCTCCCTCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAAGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAGAAA
TTTCTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCTTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGAGGGAGC[G/A]
TGAGGCTTCCCGGTATCGCTTTAGAGAGCAATTGAGTTGAGTTTTGAGTTACGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 0.70% | 6.33% | 7.51% | NA |
| All Indica | 2759 | 80.00% | 0.40% | 7.76% | 11.85% | NA |
| All Japonica | 1512 | 94.50% | 1.50% | 3.97% | 0.07% | NA |
| Aus | 269 | 84.80% | 0.00% | 7.43% | 7.81% | NA |
| Indica I | 595 | 77.30% | 1.80% | 16.64% | 4.20% | NA |
| Indica II | 465 | 78.30% | 0.00% | 8.39% | 13.33% | NA |
| Indica III | 913 | 84.30% | 0.10% | 1.97% | 13.58% | NA |
| Indica Intermediate | 786 | 77.90% | 0.00% | 7.38% | 14.76% | NA |
| Temperate Japonica | 767 | 91.90% | 2.20% | 5.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.40% | 2.10% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 90.00% | 1.10% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418797097 | C -> DEL | N | N | silent_mutation | Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0418797097 | C -> T | LOC_Os04g31420.1 | upstream_gene_variant ; 1509.0bp to feature; MODIFIER | silent_mutation | Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0418797097 | C -> T | LOC_Os04g31430.1 | upstream_gene_variant ; 3926.0bp to feature; MODIFIER | silent_mutation | Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0418797097 | C -> T | LOC_Os04g31420-LOC_Os04g31430 | intergenic_region ; MODIFIER | silent_mutation | Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418797097 | NA | 3.57E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | 2.16E-06 | NA | mr1089_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | 8.82E-07 | 9.33E-08 | mr1109_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | 2.55E-06 | 2.07E-07 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | 5.59E-06 | 1.58E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | NA | 1.45E-07 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418797097 | NA | 2.76E-08 | mr1458_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |