\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418797097:

Variant ID: vg0418797097 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18797097
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCGTAACTCAAAACTCAACTCAATTGCTCTCTAAAGCGATACCGGGAAGCCTCA[C/T]
GCTCCCTCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAAGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAGAAA

Reverse complement sequence

TTTCTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCTTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGAGGGAGC[G/A]
TGAGGCTTCCCGGTATCGCTTTAGAGAGCAATTGAGTTGAGTTTTGAGTTACGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 0.70% 6.33% 7.51% NA
All Indica  2759 80.00% 0.40% 7.76% 11.85% NA
All Japonica  1512 94.50% 1.50% 3.97% 0.07% NA
Aus  269 84.80% 0.00% 7.43% 7.81% NA
Indica I  595 77.30% 1.80% 16.64% 4.20% NA
Indica II  465 78.30% 0.00% 8.39% 13.33% NA
Indica III  913 84.30% 0.10% 1.97% 13.58% NA
Indica Intermediate  786 77.90% 0.00% 7.38% 14.76% NA
Temperate Japonica  767 91.90% 2.20% 5.87% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.79% 0.20% NA
Japonica Intermediate  241 93.40% 2.10% 4.56% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 90.00% 1.10% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418797097 C -> DEL N N silent_mutation Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 N N N N
vg0418797097 C -> T LOC_Os04g31420.1 upstream_gene_variant ; 1509.0bp to feature; MODIFIER silent_mutation Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 N N N N
vg0418797097 C -> T LOC_Os04g31430.1 upstream_gene_variant ; 3926.0bp to feature; MODIFIER silent_mutation Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 N N N N
vg0418797097 C -> T LOC_Os04g31420-LOC_Os04g31430 intergenic_region ; MODIFIER silent_mutation Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418797097 NA 3.57E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 2.16E-06 NA mr1089_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 8.82E-07 9.33E-08 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 2.55E-06 2.07E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 5.59E-06 1.58E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 NA 1.45E-07 mr1457_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097 NA 2.76E-08 mr1458_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251