Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418797097:

Variant ID: vg0418797097 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18797097
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCGTAACTCAAAACTCAACTCAATTGCTCTCTAAAGCGATACCGGGAAGCCTCA[C/T]
GCTCCCTCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAAGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAGAAA

Reverse complement sequence

TTTCTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCTTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGAGGGAGC[G/A]
TGAGGCTTCCCGGTATCGCTTTAGAGAGCAATTGAGTTGAGTTTTGAGTTACGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	0.70%	6.33%	7.51%	NA
All Indica	2759	80.00%	0.40%	7.76%	11.85%	NA
All Japonica	1512	94.50%	1.50%	3.97%	0.07%	NA
Aus	269	84.80%	0.00%	7.43%	7.81%	NA
Indica I	595	77.30%	1.80%	16.64%	4.20%	NA
Indica II	465	78.30%	0.00%	8.39%	13.33%	NA
Indica III	913	84.30%	0.10%	1.97%	13.58%	NA
Indica Intermediate	786	77.90%	0.00%	7.38%	14.76%	NA
Temperate Japonica	767	91.90%	2.20%	5.87%	0.00%	NA
Tropical Japonica	504	99.00%	0.00%	0.79%	0.20%	NA
Japonica Intermediate	241	93.40%	2.10%	4.56%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	90.00%	1.10%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418797097	C -> DEL	N	N	silent_mutation	Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193	N	N	N	N
vg0418797097	C -> T	LOC_Os04g31420.1	upstream_gene_variant ; 1509.0bp to feature; MODIFIER	silent_mutation	Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193	N	N	N	N
vg0418797097	C -> T	LOC_Os04g31430.1	upstream_gene_variant ; 3926.0bp to feature; MODIFIER	silent_mutation	Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193	N	N	N	N
vg0418797097	C -> T	LOC_Os04g31420-LOC_Os04g31430	intergenic_region ; MODIFIER	silent_mutation	Average:18.904; most accessible tissue: Zhenshan97 flower, score: 44.193	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418797097	NA	3.57E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	2.16E-06	NA	mr1089_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	8.82E-07	9.33E-08	mr1109_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	2.55E-06	2.07E-07	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	5.59E-06	1.58E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	NA	1.45E-07	mr1457_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418797097	NA	2.76E-08	mr1458_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251