\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0418762339:

Variant ID: vg0418762339 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18762339
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGTGGTATATATGTATATCAAAGAAAGCTTAAGAGTTTGTTCAATGGTAGAGACGACTATGGTCTCTTAAACAATGCTATAAGATTATTTAGAGAC[C/T]
ATGTCTTTACAATAGTTAAGACGATAAAAACTCTAATCATTATCTCAAAAAATATTCCTTTTCTTAATATTCTTTCCATTTTTTTACCCTCATGCAACCA

Reverse complement sequence

TGGTTGCATGAGGGTAAAAAAATGGAAAGAATATTAAGAAAAGGAATATTTTTTGAGATAATGATTAGAGTTTTTATCGTCTTAACTATTGTAAAGACAT[G/A]
GTCTCTAAATAATCTTATAGCATTGTTTAAGAGACCATAGTCGTCTCTACCATTGAACAAACTCTTAAGCTTTCTTTGATATACATATATACCACTCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 37.70% 0.93% 0.00% NA
All Indica  2759 84.70% 14.90% 0.47% 0.00% NA
All Japonica  1512 23.90% 74.50% 1.59% 0.00% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 81.70% 17.00% 1.34% 0.00% NA
Indica II  465 64.50% 35.30% 0.22% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.40% 0.51% 0.00% NA
Temperate Japonica  767 37.40% 60.60% 1.96% 0.00% NA
Tropical Japonica  504 4.00% 95.40% 0.60% 0.00% NA
Japonica Intermediate  241 22.40% 75.10% 2.49% 0.00% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 30.00% 63.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418762339 C -> T LOC_Os04g31350.1 upstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0418762339 C -> T LOC_Os04g31360.1 upstream_gene_variant ; 640.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0418762339 C -> T LOC_Os04g31370.1 upstream_gene_variant ; 3082.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0418762339 C -> T LOC_Os04g31360-LOC_Os04g31370 intergenic_region ; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418762339 C T -0.01 0.0 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418762339 NA 5.87E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 1.12E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 8.51E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 1.36E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 1.48E-10 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 2.23E-10 8.59E-13 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 9.39E-15 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 1.10E-09 8.24E-14 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 5.13E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 5.00E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 6.44E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 1.10E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 6.95E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 NA 4.09E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 6.16E-07 4.02E-06 mr1851_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762339 8.02E-06 4.71E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251