\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418575339:

Variant ID: vg0418575339 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18575339
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGACTAAAAACCGAAAACCGAAAACCGAGACCGGAATTTTCGGTCTGACCGAATGCACTCCGCAGTGTGTGTGTCCTATCGAGAAGAACGGATGGT[T/C]
TGGGCTAACTGTTTGATGCGAGGATGGTCCAACTAAATGGAAGGACGGTACTATCCAGGGCACTAAAGAGATGGTCCGTTTTGTGAGCCGGTATGTCCTA

Reverse complement sequence

TAGGACATACCGGCTCACAAAACGGACCATCTCTTTAGTGCCCTGGATAGTACCGTCCTTCCATTTAGTTGGACCATCCTCGCATCAAACAGTTAGCCCA[A/G]
ACCATCCGTTCTTCTCGATAGGACACACACACTGCGGAGTGCATTCGGTCAGACCGAAAATTCCGGTCTCGGTTTTCGGTTTTCGGTTTTTAGTCAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 18.20% 0.61% 46.97% NA
All Indica  2759 20.80% 2.30% 0.98% 75.93% NA
All Japonica  1512 52.60% 47.20% 0.00% 0.20% NA
Aus  269 61.00% 0.00% 0.37% 38.66% NA
Indica I  595 39.70% 0.70% 1.01% 58.66% NA
Indica II  465 36.80% 5.80% 0.86% 56.56% NA
Indica III  913 2.10% 0.80% 0.88% 96.28% NA
Indica Intermediate  786 18.80% 3.20% 1.15% 76.84% NA
Temperate Japonica  767 89.20% 10.70% 0.00% 0.13% NA
Tropical Japonica  504 10.30% 89.30% 0.00% 0.40% NA
Japonica Intermediate  241 24.50% 75.50% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 54.20% 0.00% 4.17% NA
Intermediate  90 47.80% 35.60% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418575339 T -> C LOC_Os04g31080.1 upstream_gene_variant ; 2533.0bp to feature; MODIFIER silent_mutation Average:83.247; most accessible tissue: Zhenshan97 flower, score: 92.513 N N N N
vg0418575339 T -> C LOC_Os04g31070-LOC_Os04g31080 intergenic_region ; MODIFIER silent_mutation Average:83.247; most accessible tissue: Zhenshan97 flower, score: 92.513 N N N N
vg0418575339 T -> DEL N N silent_mutation Average:83.247; most accessible tissue: Zhenshan97 flower, score: 92.513 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418575339 T C 0.0 0.05 0.03 0.1 -0.06 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418575339 NA 6.05E-16 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418575339 NA 3.86E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 8.23E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.08E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 4.90E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 5.04E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 5.32E-10 mr1229 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.93E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 9.49E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.49E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 3.81E-11 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 3.29E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 3.39E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.16E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 3.90E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.20E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.70E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 3.27E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.34E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.90E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.90E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.63E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 2.18E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.51E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 1.11E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 7.13E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 6.53E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418575339 NA 5.80E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251