\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418469682:

Variant ID: vg0418469682 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18469682
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTACCGGGAAGACGATGAACCAGCTTCAAGTAATAAAAGAAAGAAGTTTTTGATGTACCTTAAATAAAGACAGGCCTTTTGTATTCTTATTTAATT[C/T]
TTATCTGCCTGTGCATTATGTTAAGAATCAATTGATCCACGGGATTTGCGATTGAAGCTTCAGAAGAAAAGCTCTCAGCAAAGCTTTGCTGGCCAAAGGG

Reverse complement sequence

CCCTTTGGCCAGCAAAGCTTTGCTGAGAGCTTTTCTTCTGAAGCTTCAATCGCAAATCCCGTGGATCAATTGATTCTTAACATAATGCACAGGCAGATAA[G/A]
AATTAAATAAGAATACAAAAGGCCTGTCTTTATTTAAGGTACATCAAAAACTTCTTTCTTTTATTACTTGAAGCTGGTTCATCGTCTTCCCGGTAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 2.70% 0.70% 0.00% NA
All Indica  2759 99.90% 0.10% 0.07% 0.00% NA
All Japonica  1512 89.90% 8.10% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 96.70% 2.20% 1.04% 0.00% NA
Tropical Japonica  504 83.50% 14.30% 2.18% 0.00% NA
Japonica Intermediate  241 81.70% 13.70% 4.56% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418469682 C -> T LOC_Os04g30910.3 5_prime_UTR_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:62.184; most accessible tissue: Callus, score: 77.877 N N N N
vg0418469682 C -> T LOC_Os04g30910.1 intron_variant ; MODIFIER silent_mutation Average:62.184; most accessible tissue: Callus, score: 77.877 N N N N
vg0418469682 C -> T LOC_Os04g30910.2 intron_variant ; MODIFIER silent_mutation Average:62.184; most accessible tissue: Callus, score: 77.877 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418469682 6.64E-06 6.64E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 4.83E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 4.57E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 6.21E-08 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 8.14E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 6.75E-10 mr1213 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 2.05E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 1.26E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 5.33E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 2.43E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 6.69E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 7.38E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 9.20E-08 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 3.41E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 6.11E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418469682 NA 9.88E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251