Variant ID: vg0418469682 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 18469682 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCTTTACCGGGAAGACGATGAACCAGCTTCAAGTAATAAAAGAAAGAAGTTTTTGATGTACCTTAAATAAAGACAGGCCTTTTGTATTCTTATTTAATT[C/T]
TTATCTGCCTGTGCATTATGTTAAGAATCAATTGATCCACGGGATTTGCGATTGAAGCTTCAGAAGAAAAGCTCTCAGCAAAGCTTTGCTGGCCAAAGGG
CCCTTTGGCCAGCAAAGCTTTGCTGAGAGCTTTTCTTCTGAAGCTTCAATCGCAAATCCCGTGGATCAATTGATTCTTAACATAATGCACAGGCAGATAA[G/A]
AATTAAATAAGAATACAAAAGGCCTGTCTTTATTTAAGGTACATCAAAAACTTCTTTCTTTTATTACTTGAAGCTGGTTCATCGTCTTCCCGGTAAAGAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.60% | 2.70% | 0.70% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 89.90% | 8.10% | 1.98% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 96.70% | 2.20% | 1.04% | 0.00% | NA |
Tropical Japonica | 504 | 83.50% | 14.30% | 2.18% | 0.00% | NA |
Japonica Intermediate | 241 | 81.70% | 13.70% | 4.56% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0418469682 | C -> T | LOC_Os04g30910.3 | 5_prime_UTR_variant ; 127.0bp to feature; MODIFIER | silent_mutation | Average:62.184; most accessible tissue: Callus, score: 77.877 | N | N | N | N |
vg0418469682 | C -> T | LOC_Os04g30910.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.184; most accessible tissue: Callus, score: 77.877 | N | N | N | N |
vg0418469682 | C -> T | LOC_Os04g30910.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.184; most accessible tissue: Callus, score: 77.877 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0418469682 | 6.64E-06 | 6.64E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 4.83E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 4.57E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 6.21E-08 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 8.14E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 6.75E-10 | mr1213 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 2.05E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 1.26E-07 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 5.33E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0418469682 | NA | 2.43E-14 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/