Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418242514:

Variant ID: vg0418242514 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18242514
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.30, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGAACATTAGTTGCTTGTAATTTTACCTTATCTGTTGCTCACTTGCAATTGATTTTACTCTGTAACTTGGAAGTATATTACTTCCTCCGTTTCATAAT[A/G]
TAAGTCATTTTAGCATTATCCACATTCATATAGATGTTAATGAATCTAGACATATGCTATATCTAGATTCATTAACATCGCTATGTCTAGATTCATTAAC

Reverse complement sequence

GTTAATGAATCTAGACATAGCGATGTTAATGAATCTAGATATAGCATATGTCTAGATTCATTAACATCTATATGAATGTGGATAATGCTAAAATGACTTA[T/C]
ATTATGAAACGGAGGAAGTAATATACTTCCAAGTTACAGAGTAAAATCAATTGCAAGTGAGCAACAGATAAGGTAAAATTACAAGCAACTAATGTTCAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	37.70%	0.36%	13.65%	NA
All Indica	2759	77.40%	20.60%	0.47%	1.56%	NA
All Japonica	1512	1.00%	60.30%	0.13%	38.62%	NA
Aus	269	37.50%	62.50%	0.00%	0.00%	NA
Indica I	595	61.00%	37.60%	0.67%	0.67%	NA
Indica II	465	58.10%	36.80%	0.65%	4.52%	NA
Indica III	913	96.10%	3.10%	0.33%	0.55%	NA
Indica Intermediate	786	79.60%	18.30%	0.38%	1.65%	NA
Temperate Japonica	767	0.40%	90.40%	0.00%	9.26%	NA
Tropical Japonica	504	1.60%	28.60%	0.40%	69.44%	NA
Japonica Intermediate	241	1.70%	30.70%	0.00%	67.63%	NA
VI/Aromatic	96	6.20%	87.50%	1.04%	5.21%	NA
Intermediate	90	25.60%	58.90%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418242514	A -> DEL	N	N	silent_mutation	Average:32.408; most accessible tissue: Callus, score: 58.986	N	N	N	N
vg0418242514	A -> G	LOC_Os04g30530.1	upstream_gene_variant ; 4930.0bp to feature; MODIFIER	silent_mutation	Average:32.408; most accessible tissue: Callus, score: 58.986	N	N	N	N
vg0418242514	A -> G	LOC_Os04g30520.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:32.408; most accessible tissue: Callus, score: 58.986	N	N	N	N
vg0418242514	A -> G	LOC_Os04g30520-LOC_Os04g30530	intergenic_region ; MODIFIER	silent_mutation	Average:32.408; most accessible tissue: Callus, score: 58.986	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418242514	2.43E-07	2.42E-07	mr1590	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	6.19E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	1.31E-06	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	5.47E-09	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	4.30E-07	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	3.35E-06	2.61E-08	mr1964	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	1.01E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	3.79E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418242514	NA	2.72E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251