Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418136371:

Variant ID: vg0418136371 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 18136371
Reference Allele: G	Alternative Allele: GACAAGCACTAGCAGGAGGCATCGTGATCCAATAGA,GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA
Primary Allele: G	Secondary Allele: GACAAGCACTAGCAGGAGGC ATCGTGATCCAATAGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATCTGGCCACCCCTGAACTCGTGGCGGCCATATTTGACTACCCCTGGGCTCATCGCAGCTAGATCTGACGACCTAACATCGACACTGGACCACACTAG[G/GACAAGCACTAGCAGGAGGCATCGTGATCCAATAGA,GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA]
ACAAAGATTTCTGCTAGGGCTGCAGTGGAGGAGGTGAGGGCGAAGCGATTTCCACAGCGGCCACAAAGAGGTGGGGGAGGAGGTCTCCACCGGCGCACAC

Reverse complement sequence

GTGTGCGCCGGTGGAGACCTCCTCCCCCACCTCTTTGTGGCCGCTGTGGAAATCGCTTCGCCCTCACCTCCTCCACTGCAGCCCTAGCAGAAATCTTTGT[C/TCTATTGGATCACGATGCCTCCTGCTAGTGCTTGTC,TCTATTGGATCACGATACCTCCTGCTAGTGCTTGTC]
CTAGTGTGGTCCAGTGTCGATGTTAGGTCGTCAGATCTAGCTGCGATGAGCCCAGGGGTAGTCAAATATGGCCGCCACGAGTTCAGGGGTGGCCAGATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GACAAGCACTAGCAGGAGGC ATCGTGATCCAATAGA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	12.60%	1.54%	3.91%	GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.02%
All Indica	2759	89.50%	1.30%	2.54%	6.67%	NA
All Japonica	1512	65.30%	34.50%	0.13%	0.07%	GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.00%	0.17%	NA
Indica II	465	92.30%	4.50%	1.08%	2.15%	NA
Indica III	913	79.70%	0.20%	5.48%	14.57%	NA
Indica Intermediate	786	91.70%	1.30%	1.91%	5.09%	NA
Temperate Japonica	767	97.00%	3.00%	0.00%	0.00%	NA
Tropical Japonica	504	29.40%	70.00%	0.40%	0.20%	NA
Japonica Intermediate	241	39.40%	60.20%	0.00%	0.00%	GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.41%
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418136371	G -> DEL	N	N	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA	LOC_Os04g30380.1	upstream_gene_variant ; 4695.0bp to feature; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA	LOC_Os04g30390.1	upstream_gene_variant ; 1252.0bp to feature; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA	LOC_Os04g30380-LOC_Os04g30390	intergenic_region ; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA	LOC_Os04g30380.1	upstream_gene_variant ; 4695.0bp to feature; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA	LOC_Os04g30390.1	upstream_gene_variant ; 1252.0bp to feature; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N
vg0418136371	G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA	LOC_Os04g30380-LOC_Os04g30390	intergenic_region ; MODIFIER	silent_mutation	Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0418136371	G	GACAA*	0.16	-0.02	-0.05	0.08	0.1	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418136371	NA	7.10E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	NA	1.41E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	NA	1.67E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	NA	6.72E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	5.38E-06	NA	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	NA	2.22E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	1.38E-08	7.97E-12	mr1498_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371	NA	4.83E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251