\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418136371:

Variant ID: vg0418136371 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 18136371
Reference Allele: GAlternative Allele: GACAAGCACTAGCAGGAGGCATCGTGATCCAATAGA,GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA
Primary Allele: GSecondary Allele: GACAAGCACTAGCAGGAGGC ATCGTGATCCAATAGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCTGGCCACCCCTGAACTCGTGGCGGCCATATTTGACTACCCCTGGGCTCATCGCAGCTAGATCTGACGACCTAACATCGACACTGGACCACACTAG[G/GACAAGCACTAGCAGGAGGCATCGTGATCCAATAGA,GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA]
ACAAAGATTTCTGCTAGGGCTGCAGTGGAGGAGGTGAGGGCGAAGCGATTTCCACAGCGGCCACAAAGAGGTGGGGGAGGAGGTCTCCACCGGCGCACAC

Reverse complement sequence

GTGTGCGCCGGTGGAGACCTCCTCCCCCACCTCTTTGTGGCCGCTGTGGAAATCGCTTCGCCCTCACCTCCTCCACTGCAGCCCTAGCAGAAATCTTTGT[C/TCTATTGGATCACGATGCCTCCTGCTAGTGCTTGTC,TCTATTGGATCACGATACCTCCTGCTAGTGCTTGTC]
CTAGTGTGGTCCAGTGTCGATGTTAGGTCGTCAGATCTAGCTGCGATGAGCCCAGGGGTAGTCAAATATGGCCGCCACGAGTTCAGGGGTGGCCAGATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GACAAGCACTAGCAGGAGGC ATCGTGATCCAATAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 12.60% 1.54% 3.91% GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.02%
All Indica  2759 89.50% 1.30% 2.54% 6.67% NA
All Japonica  1512 65.30% 34.50% 0.13% 0.07% GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 92.30% 4.50% 1.08% 2.15% NA
Indica III  913 79.70% 0.20% 5.48% 14.57% NA
Indica Intermediate  786 91.70% 1.30% 1.91% 5.09% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 29.40% 70.00% 0.40% 0.20% NA
Japonica Intermediate  241 39.40% 60.20% 0.00% 0.00% GACAAGCACTAGCAGGAGGTATCGTGATCCAATAGA: 0.41%
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418136371 G -> DEL N N silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA LOC_Os04g30380.1 upstream_gene_variant ; 4695.0bp to feature; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA LOC_Os04g30390.1 upstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGTATCGTGATCC AATAGA LOC_Os04g30380-LOC_Os04g30390 intergenic_region ; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA LOC_Os04g30380.1 upstream_gene_variant ; 4695.0bp to feature; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA LOC_Os04g30390.1 upstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N
vg0418136371 G -> GACAAGCACTAGCAGGAGGCATCGTGATCC AATAGA LOC_Os04g30380-LOC_Os04g30390 intergenic_region ; MODIFIER silent_mutation Average:76.145; most accessible tissue: Zhenshan97 panicle, score: 96.528 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418136371 G GACAA* 0.16 -0.02 -0.05 0.08 0.1 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418136371 NA 7.10E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 NA 1.41E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 NA 1.67E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 NA 6.72E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 5.38E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 NA 2.22E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 1.38E-08 7.97E-12 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418136371 NA 4.83E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251