Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418098488:

Variant ID: vg0418098488 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18098488
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

GTGAGTGATGTTGGAATGACCAAGCTGGCTCATGCACAGAAATTACAGTCTCTGGTCGTTGGTGGCTGTCCTAAGATCTCTGAGAAAGGCGTGCAGGGTG[C/T]
TGCCAAATCAGTCTGCTATGAAGTCAATTGTGAAAACCTTGCCCATTATTTGCGAATCTGGCAAAGCTGTCATGCCGTTGCTTAGAGCACATTGTCATCG

Reverse complement sequence

CGATGACAATGTGCTCTAAGCAACGGCATGACAGCTTTGCCAGATTCGCAAATAATGGGCAAGGTTTTCACAATTGACTTCATAGCAGACTGATTTGGCA[G/A]
CACCCTGCACGCCTTTCTCAGAGATCTTAGGACAGCCACCAACGACCAGAGACTGTAATTTCTGTGCATGAGCCAGCTTGGTCATTCCAACATCACTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	2.90%	1.95%	42.15%	NA
All Indica	2759	24.60%	4.80%	3.19%	67.45%	NA
All Japonica	1512	99.40%	0.00%	0.07%	0.53%	NA
Aus	269	61.30%	0.40%	0.37%	37.92%	NA
Indica I	595	45.00%	0.70%	1.68%	52.61%	NA
Indica II	465	43.70%	9.90%	3.01%	43.44%	NA
Indica III	913	3.70%	1.60%	3.83%	90.80%	NA
Indica Intermediate	786	22.00%	8.50%	3.69%	65.78%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	91.70%	0.00%	2.08%	6.25%	NA
Intermediate	90	81.10%	2.20%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418098488	C -> DEL	N	N	silent_mutation	Average:63.622; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0418098488	C -> T	LOC_Os04g30320.1	3_prime_UTR_variant ; 370.0bp to feature; MODIFIER	silent_mutation	Average:63.622; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0418098488	C -> T	LOC_Os04g30310.1	upstream_gene_variant ; 4402.0bp to feature; MODIFIER	silent_mutation	Average:63.622; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0418098488	C -> T	LOC_Os04g30330.1	downstream_gene_variant ; 660.0bp to feature; MODIFIER	silent_mutation	Average:63.622; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418098488	NA	1.09E-06	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418098488	NA	6.91E-08	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418098488	NA	2.68E-06	mr1177_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418098488	3.52E-06	1.22E-07	mr1929_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251