\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418087592:

Variant ID: vg0418087592 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18087592
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCTCGATGAGCACGGCGATGAAGCTATGCTGAGGAGGGCGCGTCTCAACACTGCAACAACAAGTGAAGGTGGACCACGGGCGGCAGCACTGCAGTCCG[A/T]
GGTGGCAACGAAATGGCAACCCGAAGCTTGATGGTGTAGCGCATGCTCGATGACGATCGGTTACAGAAGTCATTGTAGCCGAGAACTTGAACGGATGATC

Reverse complement sequence

GATCATCCGTTCAAGTTCTCGGCTACAATGACTTCTGTAACCGATCGTCATCGAGCATGCGCTACACCATCAAGCTTCGGGTTGCCATTTCGTTGCCACC[T/A]
CGGACTGCAGTGCTGCCGCCCGTGGTCCACCTTCACTTGTTGTTGCAGTGTTGAGACGCGCCCTCCTCAGCATAGCTTCATCGCCGTGCTCATCGAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 4.00% 0.72% 11.64% NA
All Indica  2759 90.30% 0.30% 0.51% 8.92% NA
All Japonica  1512 69.00% 11.60% 1.12% 18.32% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 93.10% 0.20% 1.08% 5.59% NA
Indica III  913 80.40% 0.10% 0.77% 18.73% NA
Indica Intermediate  786 93.00% 0.50% 0.25% 6.23% NA
Temperate Japonica  767 97.30% 2.60% 0.13% 0.00% NA
Tropical Japonica  504 37.10% 16.70% 2.78% 43.45% NA
Japonica Intermediate  241 45.60% 29.50% 0.83% 24.07% NA
VI/Aromatic  96 85.40% 2.10% 1.04% 11.46% NA
Intermediate  90 87.80% 3.30% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418087592 A -> DEL LOC_Os04g30290.1 N frameshift_variant Average:75.409; most accessible tissue: Minghui63 flag leaf, score: 94.967 N N N N
vg0418087592 A -> T LOC_Os04g30290.1 missense_variant ; p.Glu197Val; MODERATE nonsynonymous_codon ; E197V Average:75.409; most accessible tissue: Minghui63 flag leaf, score: 94.967 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418087592 A T -0.01 -0.01 0.0 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418087592 NA 5.00E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 2.81E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 1.75E-12 1.80E-29 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 1.50E-06 1.09E-20 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 7.97E-09 7.12E-19 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 7.94E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 2.97E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 1.85E-09 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 2.78E-06 2.75E-09 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 3.05E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 5.01E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 1.59E-06 mr1689 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 3.39E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 6.19E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 4.65E-11 9.84E-29 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 2.50E-20 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 2.99E-07 3.95E-18 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 5.08E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 NA 6.34E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 2.33E-06 4.52E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087592 8.18E-06 5.31E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251