\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418087588:

Variant ID: vg0418087588 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18087588
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATGGCTCGATGAGCACGGCGATGAAGCTATGCTGAGGAGGGCGCGTCTCAACACTGCAACAACAAGTGAAGGTGGACCACGGGCGGCAGCACTGCAG[T/C]
CCGAGGTGGCAACGAAATGGCAACCCGAAGCTTGATGGTGTAGCGCATGCTCGATGACGATCGGTTACAGAAGTCATTGTAGCCGAGAACTTGAACGGAT

Reverse complement sequence

ATCCGTTCAAGTTCTCGGCTACAATGACTTCTGTAACCGATCGTCATCGAGCATGCGCTACACCATCAAGCTTCGGGTTGCCATTTCGTTGCCACCTCGG[A/G]
CTGCAGTGCTGCCGCCCGTGGTCCACCTTCACTTGTTGTTGCAGTGTTGAGACGCGCCCTCCTCAGCATAGCTTCATCGCCGTGCTCATCGAGCCATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.30% 39.80% 0.78% 13.16% NA
All Indica  2759 67.10% 21.20% 0.69% 10.98% NA
All Japonica  1512 12.60% 67.40% 0.86% 19.11% NA
Aus  269 41.60% 53.90% 0.37% 4.09% NA
Indica I  595 59.00% 39.00% 0.67% 1.34% NA
Indica II  465 51.60% 39.10% 1.08% 8.17% NA
Indica III  913 77.40% 2.50% 0.55% 19.50% NA
Indica Intermediate  786 70.50% 18.80% 0.64% 10.05% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 18.50% 33.90% 1.98% 45.63% NA
Japonica Intermediate  241 31.10% 43.20% 1.24% 24.48% NA
VI/Aromatic  96 10.40% 77.10% 2.08% 10.42% NA
Intermediate  90 23.30% 64.40% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418087588 T -> C LOC_Os04g30290.1 missense_variant ; p.Ser196Pro; MODERATE nonsynonymous_codon ; S196P Average:75.733; most accessible tissue: Minghui63 flag leaf, score: 95.215 unknown unknown TOLERATED 0.07
vg0418087588 T -> DEL LOC_Os04g30290.1 N frameshift_variant Average:75.733; most accessible tissue: Minghui63 flag leaf, score: 95.215 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418087588 T C -0.01 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418087588 7.39E-06 2.26E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 4.47E-06 1.06E-06 mr1228_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 1.45E-06 1.45E-06 mr1230_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 8.64E-06 7.95E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 5.71E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 7.77E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 6.50E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 7.13E-06 7.13E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 8.68E-06 8.67E-06 mr1487_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 3.14E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 1.91E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 3.73E-08 3.72E-08 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 5.58E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 1.02E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 5.79E-06 5.79E-06 mr1610_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 2.16E-06 2.15E-06 mr1869_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 1.13E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 6.56E-06 6.56E-06 mr1904_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418087588 NA 2.27E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251