\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418084715:

Variant ID: vg0418084715 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18084715
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CACTACTACATAAACAATTTTCCTAAAAGAGGCCCACGTTAGGTTGCAAATGGATCATAATTGACCGCGTCTGCAGAAATCGACCTCCATTTTCGCATAC[G/A]
GACATGTATTGAAAAAAAAATCAATTTTCGTATATGGGCGTCTTAACAGGCCCGCACGCGAAAGTAATATATTTTCGCAGGCAGGCCACTTAAGAGACCC

Reverse complement sequence

GGGTCTCTTAAGTGGCCTGCCTGCGAAAATATATTACTTTCGCGTGCGGGCCTGTTAAGACGCCCATATACGAAAATTGATTTTTTTTTCAATACATGTC[C/T]
GTATGCGAAAATGGAGGTCGATTTCTGCAGACGCGGTCAATTATGATCCATTTGCAACCTAACGTGGGCCTCTTTTAGGAAAATTGTTTATGTAGTAGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 39.50% 1.59% 14.98% NA
All Indica  2759 63.00% 21.30% 2.32% 13.45% NA
All Japonica  1512 12.60% 66.80% 0.26% 20.37% NA
Aus  269 43.90% 51.70% 0.74% 3.72% NA
Indica I  595 58.70% 38.80% 2.02% 0.50% NA
Indica II  465 47.10% 39.10% 3.87% 9.89% NA
Indica III  913 70.80% 2.10% 0.55% 26.62% NA
Indica Intermediate  786 66.50% 19.70% 3.69% 10.05% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 18.70% 32.50% 0.40% 48.41% NA
Japonica Intermediate  241 30.30% 42.30% 0.83% 26.56% NA
VI/Aromatic  96 12.50% 75.00% 1.04% 11.46% NA
Intermediate  90 23.30% 63.30% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418084715 G -> DEL N N silent_mutation Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0418084715 G -> A LOC_Os04g30280.1 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0418084715 G -> A LOC_Os04g30290.1 upstream_gene_variant ; 1892.0bp to feature; MODIFIER silent_mutation Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0418084715 G -> A LOC_Os04g30300.1 downstream_gene_variant ; 3196.0bp to feature; MODIFIER silent_mutation Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N
vg0418084715 G -> A LOC_Os04g30280-LOC_Os04g30290 intergenic_region ; MODIFIER silent_mutation Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418084715 G A 0.24 0.05 0.02 0.01 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418084715 NA 1.30E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 5.43E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 6.49E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 1.56E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 7.56E-07 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 2.51E-06 2.51E-06 mr1228 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 7.74E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 7.67E-06 3.30E-08 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 2.37E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 4.25E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 2.47E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 4.50E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 2.19E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 5.42E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715 NA 3.89E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251