\
| Variant ID: vg0418083292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18083292 |
| Reference Allele: C | Alternative Allele: G,T,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.03, others allele: 0.00, population size: 68. )
TTTTACCTTGGCAACCATCCTGTCGATAAGGATTTCCTTGGTACCCGTTTGTGCAATTGCATATATAGCCTGGTCCATTGGAGGAATTGAAGCACTCGCT[C/G,T,A]
TTGTCACTTTTACACGCGTATAACGTGAGATTTTTTTGTGCTTCGTCACAGTTGTTCACAGTTCGGATAGCCCAATCCAGTAGCATTGGCGCCCGGCCGC
GCGGCCGGGCGCCAATGCTACTGGATTGGGCTATCCGAACTGTGAACAACTGTGACGAAGCACAAAAAAATCTCACGTTATACGCGTGTAAAAGTGACAA[G/C,A,T]
AGCGAGTGCTTCAATTCCTCCAATGGACCAGGCTATATATGCAATTGCACAAACGGGTACCAAGGAAATCCTTATCGACAGGATGGTTGCCAAGGTAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 42.70% | 1.21% | 5.78% | A: 0.02% |
| All Indica | 2759 | 68.40% | 21.00% | 1.23% | 9.35% | A: 0.04% |
| All Japonica | 1512 | 21.10% | 77.10% | 0.93% | 0.93% | NA |
| Aus | 269 | 45.70% | 53.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 60.50% | 37.50% | 0.50% | 1.51% | NA |
| Indica II | 465 | 54.80% | 39.40% | 1.51% | 4.30% | NA |
| Indica III | 913 | 78.20% | 2.10% | 0.77% | 18.84% | A: 0.11% |
| Indica Intermediate | 786 | 70.90% | 19.70% | 2.16% | 7.25% | NA |
| Temperate Japonica | 767 | 0.30% | 99.20% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 49.60% | 47.00% | 1.79% | 1.59% | NA |
| Japonica Intermediate | 241 | 27.80% | 69.30% | 2.07% | 0.83% | NA |
| VI/Aromatic | 96 | 21.90% | 77.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 64.40% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418083292 | C -> A | LOC_Os04g30280.1 | missense_variant ; p.Lys255Asn; MODERATE | nonsynonymous_codon ; K255N | Average:58.861; most accessible tissue: Callus, score: 74.85 | benign |
-0.205 |
TOLERATED | 1.00 |
| vg0418083292 | C -> DEL | LOC_Os04g30280.1 | N | frameshift_variant | Average:58.861; most accessible tissue: Callus, score: 74.85 | N | N | N | N |
| vg0418083292 | C -> G | LOC_Os04g30280.1 | missense_variant ; p.Lys255Asn; MODERATE | nonsynonymous_codon ; K255N | Average:58.861; most accessible tissue: Callus, score: 74.85 | benign |
-0.205 |
TOLERATED | 1.00 |
| vg0418083292 | C -> T | LOC_Os04g30280.1 | synonymous_variant ; p.Lys255Lys; LOW | N | Average:58.861; most accessible tissue: Callus, score: 74.85 | N | N | N | N |
| vg0418083292 | C -> T | LOC_Os04g30290.1 | upstream_gene_variant ; 3315.0bp to feature; MODIFIER | N | Average:58.861; most accessible tissue: Callus, score: 74.85 | N | N | N | N |
| vg0418083292 | C -> T | LOC_Os04g30300.1 | downstream_gene_variant ; 4619.0bp to feature; MODIFIER | N | Average:58.861; most accessible tissue: Callus, score: 74.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418083292 | 1.85E-08 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 5.42E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 8.35E-08 | NA | mr1082 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 4.05E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 1.30E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 1.44E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 1.67E-08 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 9.59E-06 | NA | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 1.29E-07 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 2.13E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 2.82E-11 | NA | mr1226 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 2.59E-06 | 3.42E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 1.96E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 1.43E-07 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 2.80E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 5.88E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 4.42E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | 2.38E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418083292 | NA | 3.55E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |