\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418081728:

Variant ID: vg0418081728 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18081728
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGTCTTTTATGTAGGCTGAAATTTATTTTTTATGTCGGCTCATTGAGAACTGCTTACGAAAATCTATTTTTACTAAGGCAAATTTTACTATAGGACG[C/T]
CGTGACTTCATGGATTTAGCTGTAGGACACTATCAGGGTTACGAATAAGATATACCCTCTATCCTTGGATGTACGTTGTATACTGATACGGTATACCCGC

Reverse complement sequence

GCGGGTATACCGTATCAGTATACAACGTACATCCAAGGATAGAGGGTATATCTTATTCGTAACCCTGATAGTGTCCTACAGCTAAATCCATGAAGTCACG[G/A]
CGTCCTATAGTAAAATTTGCCTTAGTAAAAATAGATTTTCGTAAGCAGTTCTCAATGAGCCGACATAAAAAATAAATTTCAGCCTACATAAAAGACATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 4.60% 2.50% 49.51% NA
All Indica  2759 27.80% 0.40% 3.23% 68.58% NA
All Japonica  1512 67.10% 11.90% 1.26% 19.78% NA
Aus  269 53.20% 3.30% 3.35% 40.15% NA
Indica I  595 47.20% 0.50% 2.35% 49.92% NA
Indica II  465 46.70% 0.40% 2.37% 50.54% NA
Indica III  913 3.60% 0.30% 3.72% 92.33% NA
Indica Intermediate  786 29.90% 0.50% 3.82% 65.78% NA
Temperate Japonica  767 97.00% 2.90% 0.00% 0.13% NA
Tropical Japonica  504 33.30% 17.30% 3.37% 46.03% NA
Japonica Intermediate  241 42.30% 29.50% 0.83% 27.39% NA
VI/Aromatic  96 67.70% 14.60% 0.00% 17.71% NA
Intermediate  90 67.80% 4.40% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418081728 C -> DEL N N silent_mutation Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0418081728 C -> T LOC_Os04g30290.1 upstream_gene_variant ; 4879.0bp to feature; MODIFIER silent_mutation Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0418081728 C -> T LOC_Os04g30280.1 intron_variant ; MODIFIER silent_mutation Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418081728 3.94E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 1.55E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 1.76E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 2.01E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 1.64E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 4.71E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 2.66E-06 NA mr1213 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 2.69E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 7.20E-09 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 3.85E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 1.86E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 8.65E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 1.09E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 9.33E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 3.76E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 1.85E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 2.46E-09 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 6.40E-06 4.44E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 3.06E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 5.02E-07 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 7.48E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 8.32E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728 NA 7.87E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251