Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418081728:

Variant ID: vg0418081728 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18081728
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATGTCTTTTATGTAGGCTGAAATTTATTTTTTATGTCGGCTCATTGAGAACTGCTTACGAAAATCTATTTTTACTAAGGCAAATTTTACTATAGGACG[C/T]
CGTGACTTCATGGATTTAGCTGTAGGACACTATCAGGGTTACGAATAAGATATACCCTCTATCCTTGGATGTACGTTGTATACTGATACGGTATACCCGC

Reverse complement sequence

GCGGGTATACCGTATCAGTATACAACGTACATCCAAGGATAGAGGGTATATCTTATTCGTAACCCTGATAGTGTCCTACAGCTAAATCCATGAAGTCACG[G/A]
CGTCCTATAGTAAAATTTGCCTTAGTAAAAATAGATTTTCGTAAGCAGTTCTCAATGAGCCGACATAAAAAATAAATTTCAGCCTACATAAAAGACATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	4.60%	2.50%	49.51%	NA
All Indica	2759	27.80%	0.40%	3.23%	68.58%	NA
All Japonica	1512	67.10%	11.90%	1.26%	19.78%	NA
Aus	269	53.20%	3.30%	3.35%	40.15%	NA
Indica I	595	47.20%	0.50%	2.35%	49.92%	NA
Indica II	465	46.70%	0.40%	2.37%	50.54%	NA
Indica III	913	3.60%	0.30%	3.72%	92.33%	NA
Indica Intermediate	786	29.90%	0.50%	3.82%	65.78%	NA
Temperate Japonica	767	97.00%	2.90%	0.00%	0.13%	NA
Tropical Japonica	504	33.30%	17.30%	3.37%	46.03%	NA
Japonica Intermediate	241	42.30%	29.50%	0.83%	27.39%	NA
VI/Aromatic	96	67.70%	14.60%	0.00%	17.71%	NA
Intermediate	90	67.80%	4.40%	1.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418081728	C -> DEL	N	N	silent_mutation	Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0418081728	C -> T	LOC_Os04g30290.1	upstream_gene_variant ; 4879.0bp to feature; MODIFIER	silent_mutation	Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0418081728	C -> T	LOC_Os04g30280.1	intron_variant ; MODIFIER	silent_mutation	Average:36.296; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418081728	3.94E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	1.55E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	1.76E-06	NA	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	2.01E-07	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	1.64E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	4.71E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	2.66E-06	NA	mr1213	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	2.69E-09	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	7.20E-09	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	3.85E-06	NA	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	1.86E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	8.65E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	1.09E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	9.33E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	3.76E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	1.85E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	2.46E-09	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	6.40E-06	4.44E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	3.06E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	5.02E-07	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	7.48E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	8.32E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418081728	NA	7.87E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251