\
| Variant ID: vg0418074959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18074959 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGTGAGAACAAAAGTGTAAGTGGGGTGATATTTGAAAGTGGGCGTACTAGTTGGATGAGCTGGGCTGTGTTGTTATAGAGGATAGGTTGTTACAAATT[G/A]
TAAACTAAAATTACTTGAATCATGTCGTAATATGTCGCAAGAATGGAGCTGGTTCATATGAAACTATAATTTATATTACATGTGTTTAGATTTTTTTAAA
TTTAAAAAAATCTAAACACATGTAATATAAATTATAGTTTCATATGAACCAGCTCCATTCTTGCGACATATTACGACATGATTCAAGTAATTTTAGTTTA[C/T]
AATTTGTAACAACCTATCCTCTATAACAACACAGCCCAGCTCATCCAACTAGTACGCCCACTTTCAAATATCACCCCACTTACACTTTTGTTCTCACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 2.70% | 1.35% | 0.02% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 88.20% | 8.10% | 3.70% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 66.70% | 23.60% | 9.72% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.70% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418074959 | G -> DEL | N | N | silent_mutation | Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0418074959 | G -> A | LOC_Os04g30270.1 | upstream_gene_variant ; 2392.0bp to feature; MODIFIER | silent_mutation | Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0418074959 | G -> A | LOC_Os04g30280.1 | downstream_gene_variant ; 3165.0bp to feature; MODIFIER | silent_mutation | Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0418074959 | G -> A | LOC_Os04g30270-LOC_Os04g30280 | intergenic_region ; MODIFIER | silent_mutation | Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418074959 | NA | 6.92E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 8.08E-06 | 3.31E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 3.20E-08 | 5.99E-08 | mr1226 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 2.08E-07 | NA | mr1411 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 1.43E-07 | 1.43E-07 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | NA | 2.11E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 1.90E-07 | 1.65E-06 | mr1104_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 7.48E-06 | NA | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418074959 | 3.26E-06 | 2.30E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |