\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418074959:

Variant ID: vg0418074959 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18074959
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTGAGAACAAAAGTGTAAGTGGGGTGATATTTGAAAGTGGGCGTACTAGTTGGATGAGCTGGGCTGTGTTGTTATAGAGGATAGGTTGTTACAAATT[G/A]
TAAACTAAAATTACTTGAATCATGTCGTAATATGTCGCAAGAATGGAGCTGGTTCATATGAAACTATAATTTATATTACATGTGTTTAGATTTTTTTAAA

Reverse complement sequence

TTTAAAAAAATCTAAACACATGTAATATAAATTATAGTTTCATATGAACCAGCTCCATTCTTGCGACATATTACGACATGATTCAAGTAATTTTAGTTTA[C/T]
AATTTGTAACAACCTATCCTCTATAACAACACAGCCCAGCTCATCCAACTAGTACGCCCACTTTCAAATATCACCCCACTTACACTTTTGTTCTCACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 2.70% 1.35% 0.02% NA
All Indica  2759 99.90% 0.00% 0.00% 0.04% NA
All Japonica  1512 88.20% 8.10% 3.70% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.00% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 23.60% 9.72% 0.00% NA
Japonica Intermediate  241 95.40% 1.70% 2.90% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418074959 G -> DEL N N silent_mutation Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0418074959 G -> A LOC_Os04g30270.1 upstream_gene_variant ; 2392.0bp to feature; MODIFIER silent_mutation Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0418074959 G -> A LOC_Os04g30280.1 downstream_gene_variant ; 3165.0bp to feature; MODIFIER silent_mutation Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0418074959 G -> A LOC_Os04g30270-LOC_Os04g30280 intergenic_region ; MODIFIER silent_mutation Average:39.77; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418074959 NA 6.92E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 8.08E-06 3.31E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 3.20E-08 5.99E-08 mr1226 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 2.08E-07 NA mr1411 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 1.43E-07 1.43E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 NA 2.11E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 1.90E-07 1.65E-06 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 7.48E-06 NA mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418074959 3.26E-06 2.30E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251