\
| Variant ID: vg0418071751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18071751 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
CTCTCGCTAGTCATTATTAAGCACTGGCTTGCTAGAGTTGCCAGATCACTTATCAATCCCATGTTATCTTCGTGCAATATTTCTGCGTCTATGAGCTCAA[G/A]
GAAGTGGCCTTCTCTCATGGCCTCTTGAAATATTAACGCGAGGCTGACCTTATCCACGGATAATGGCATTCGCCGGGTTAAGAGCTCAAGAAGAACTATA
TATAGTTCTTCTTGAGCTCTTAACCCGGCGAATGCCATTATCCGTGGATAAGGTCAGCCTCGCGTTAATATTTCAAGAGGCCATGAGAGAAGGCCACTTC[C/T]
TTGAGCTCATAGACGCAGAAATATTGCACGAAGATAACATGGGATTGATAAGTGATCTGGCAACTCTAGCAAGCCAGTGCTTAATAATGACTAGCGAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 0.30% | 1.31% | 8.59% | NA |
| All Indica | 2759 | 98.90% | 0.00% | 0.33% | 0.72% | NA |
| All Japonica | 1512 | 72.00% | 0.60% | 2.98% | 24.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 0.20% | 1.29% | 2.80% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.90% | 0.00% | 0.38% | 0.76% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 39.30% | 1.20% | 6.55% | 52.98% | NA |
| Japonica Intermediate | 241 | 57.30% | 1.20% | 4.56% | 36.93% | NA |
| VI/Aromatic | 96 | 83.30% | 2.10% | 6.25% | 8.33% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418071751 | G -> DEL | LOC_Os04g30270.1 | N | frameshift_variant | Average:66.334; most accessible tissue: Zhenshan97 young leaf, score: 91.83 | N | N | N | N |
| vg0418071751 | G -> A | LOC_Os04g30270.1 | missense_variant ; p.Leu273Phe; MODERATE | nonsynonymous_codon ; L273F | Average:66.334; most accessible tissue: Zhenshan97 young leaf, score: 91.83 | probably damaging |
2.028 |
TOLERATED | 0.81 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418071751 | 5.39E-09 | NA | mr1076 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 2.24E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 2.13E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 1.61E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 7.13E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 2.08E-08 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 7.51E-07 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 5.05E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 2.97E-10 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 3.66E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 1.07E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 1.63E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 6.72E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 1.65E-07 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 1.13E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | 3.44E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 1.70E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 6.39E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071751 | NA | 1.15E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |