Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418071652:

Variant ID: vg0418071652 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18071652
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGAAGAACTAATACCTGTAAGTACCCCTTGGTCTTGTTGTACTTGTCCCGCCATTCGCCGGCGCAATTCATCTGCAACCGTGCTCATTGTTGGTCTGC[T/A]
CTCGCTAGTCATTATTAAGCACTGGCTTGCTAGAGTTGCCAGATCACTTATCAATCCCATGTTATCTTCGTGCAATATTTCTGCGTCTATGAGCTCAAGG

Reverse complement sequence

CCTTGAGCTCATAGACGCAGAAATATTGCACGAAGATAACATGGGATTGATAAGTGATCTGGCAACTCTAGCAAGCCAGTGCTTAATAATGACTAGCGAG[A/T]
GCAGACCAACAATGAGCACGGTTGCAGATGAATTGCGCCGGCGAATGGCGGGACAAGTACAACAAGACCAAGGGGTACTTACAGGTATTAGTTCTTCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 7.80% 0.93% 2.07% NA
All Indica  2759 98.80% 0.90% 0.07% 0.14% NA
All Japonica  1512 70.20% 21.20% 2.51% 6.02% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.70% 3.90% 0.22% 0.22% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 98.70% 0.90% 0.13% 0.25% NA
Temperate Japonica  767 98.00% 0.10% 0.13% 1.69% NA
Tropical Japonica  504 37.30% 49.80% 3.57% 9.33% NA
Japonica Intermediate  241 50.60% 28.60% 7.88% 12.86% NA
VI/Aromatic  96 84.40% 11.50% 3.12% 1.04% NA
Intermediate  90 85.60% 11.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418071652 T -> DEL LOC_Os04g30270.1 N frameshift_variant Average:62.533; most accessible tissue: Zhenshan97 young leaf, score: 91.232 N N N N
vg0418071652 T -> A LOC_Os04g30270.1 missense_variant ; p.Ser306Cys; MODERATE nonsynonymous_codon ; S306C Average:62.533; most accessible tissue: Zhenshan97 young leaf, score: 91.232 probably damaging 2.376 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418071652 4.63E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 4.02E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 1.56E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 8.70E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 8.38E-09 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 6.45E-06 NA mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 1.41E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 4.42E-10 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 3.77E-06 5.64E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 5.80E-06 NA mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 9.57E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 2.00E-07 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 6.51E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 4.96E-08 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 2.43E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 5.47E-06 NA mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 2.17E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 4.10E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 9.38E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 2.16E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 4.84E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 1.74E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 1.79E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 1.36E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 3.94E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 7.27E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 9.17E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 9.16E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652 NA 1.09E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251