Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418071652:

Variant ID: vg0418071652 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18071652
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGAAGAACTAATACCTGTAAGTACCCCTTGGTCTTGTTGTACTTGTCCCGCCATTCGCCGGCGCAATTCATCTGCAACCGTGCTCATTGTTGGTCTGC[T/A]
CTCGCTAGTCATTATTAAGCACTGGCTTGCTAGAGTTGCCAGATCACTTATCAATCCCATGTTATCTTCGTGCAATATTTCTGCGTCTATGAGCTCAAGG

Reverse complement sequence

CCTTGAGCTCATAGACGCAGAAATATTGCACGAAGATAACATGGGATTGATAAGTGATCTGGCAACTCTAGCAAGCCAGTGCTTAATAATGACTAGCGAG[A/T]
GCAGACCAACAATGAGCACGGTTGCAGATGAATTGCGCCGGCGAATGGCGGGACAAGTACAACAAGACCAAGGGGTACTTACAGGTATTAGTTCTTCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.20%	7.80%	0.93%	2.07%	NA
All Indica	2759	98.80%	0.90%	0.07%	0.14%	NA
All Japonica	1512	70.20%	21.20%	2.51%	6.02%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.70%	3.90%	0.22%	0.22%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	98.70%	0.90%	0.13%	0.25%	NA
Temperate Japonica	767	98.00%	0.10%	0.13%	1.69%	NA
Tropical Japonica	504	37.30%	49.80%	3.57%	9.33%	NA
Japonica Intermediate	241	50.60%	28.60%	7.88%	12.86%	NA
VI/Aromatic	96	84.40%	11.50%	3.12%	1.04%	NA
Intermediate	90	85.60%	11.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418071652	T -> DEL	LOC_Os04g30270.1	N	frameshift_variant	Average:62.533; most accessible tissue: Zhenshan97 young leaf, score: 91.232	N	N	N	N
vg0418071652	T -> A	LOC_Os04g30270.1	missense_variant ; p.Ser306Cys; MODERATE	nonsynonymous_codon ; S306C	Average:62.533; most accessible tissue: Zhenshan97 young leaf, score: 91.232	probably damaging	2.376	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418071652	4.63E-07	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	4.02E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	1.56E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	8.70E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	8.38E-09	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	6.45E-06	NA	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	1.41E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	4.42E-10	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	3.77E-06	5.64E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	5.80E-06	NA	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	9.57E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	2.00E-07	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	6.51E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	4.96E-08	NA	mr1560	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	2.43E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	5.47E-06	NA	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	2.17E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	4.10E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	9.38E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	2.16E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	4.84E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	1.74E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	1.79E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	1.36E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	3.94E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	7.27E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	9.17E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	9.16E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418071652	NA	1.09E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251