\
| Variant ID: vg0418071347 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 18071347 |
| Reference Allele: A | Alternative Allele: G,ACTCCCTCCGTTTCACAATGTGAGACTT |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 245. )
TATATTTACGATTACTTCATATTAACTAGGCACACCTTGTGATACAACAAAGTTTTCAGAGGGACATACTACTACGTAACAAACATAATCTATAGCTACT[A/G,ACTCCCTCCGTTTCACAATGTGAGACTT]
TATAAATGGAGATACAGTAAGACAAATGTTATTGGCATATAAATAGAAGCACTCGCAATGGAACAACAAAACATGTAGTAATTGTGCGGTCATCTAGCAA
TTGCTAGATGACCGCACAATTACTACATGTTTTGTTGTTCCATTGCGAGTGCTTCTATTTATATGCCAATAACATTTGTCTTACTGTATCTCCATTTATA[T/C,AAGTCTCACATTGTGAAACGGAGGGAGT]
AGTAGCTATAGATTATGTTTGTTACGTAGTAGTATGTCCCTCTGAAAACTTTGTTGTATCACAAGGTGTGCCTAGTTAATATGAAGTAATCGTAAATATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 8.00% | 3.17% | 0.02% | NA |
| All Indica | 2759 | 98.80% | 0.90% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 69.10% | 21.60% | 9.26% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 3.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 0.10% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 35.50% | 50.80% | 13.49% | 0.20% | NA |
| Japonica Intermediate | 241 | 48.10% | 28.60% | 23.24% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 14.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 11.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418071347 | A -> ACTCCCTCCGTTTCACAATGTGAGACTT | LOC_Os04g30270.1 | intron_variant ; MODIFIER | N | Average:49.659; most accessible tissue: Zhenshan97 young leaf, score: 84.035 | N | N | N | N |
| vg0418071347 | A -> DEL | N | N | silent_mutation | Average:49.659; most accessible tissue: Zhenshan97 young leaf, score: 84.035 | N | N | N | N |
| vg0418071347 | A -> G | LOC_Os04g30270.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.659; most accessible tissue: Zhenshan97 young leaf, score: 84.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418071347 | 3.58E-07 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 1.27E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 3.34E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 7.09E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 3.58E-08 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 1.37E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 1.12E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 2.13E-06 | mr1522 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 2.44E-07 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 6.92E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 3.50E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | 3.84E-06 | 3.84E-06 | mr1146_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 6.65E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 2.74E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 2.07E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 1.44E-07 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 1.31E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 9.14E-06 | mr1759_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418071347 | NA | 7.93E-07 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |