Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418069623:

Variant ID: vg0418069623 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18069623
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCCCAACTACTCCCAGATGGTGGCACGGATGAAACCATAGTGTTTTCACTCCAACTAACTACTCCTAGCTAGCGGTGTTCCACAGTTGCGGCGGTGGC[G/A]
TCCCCACCCCGGTAGCTATGACGTTCCCACCCGAGCGGCGGTAGCGCGGTGTGGATCAAGGTGCTCGATGGCATCCCCACCCAGGCTGTGGTGGCATGGC

Reverse complement sequence

GCCATGCCACCACAGCCTGGGTGGGGATGCCATCGAGCACCTTGATCCACACCGCGCTACCGCCGCTCGGGTGGGAACGTCATAGCTACCGGGGTGGGGA[C/T]
GCCACCGCCGCAACTGTGGAACACCGCTAGCTAGGAGTAGTTAGTTGGAGTGAAAACACTATGGTTTCATCCGTGCCACCATCTGGGAGTAGTTGGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	39.20%	0.66%	16.46%	NA
All Indica	2759	69.00%	20.00%	0.62%	10.33%	NA
All Japonica	1512	0.90%	68.10%	0.66%	30.36%	NA
Aus	269	42.00%	53.90%	0.37%	3.72%	NA
Indica I	595	62.20%	36.30%	0.34%	1.18%	NA
Indica II	465	54.00%	38.30%	0.65%	7.10%	NA
Indica III	913	77.70%	1.80%	0.66%	19.93%	NA
Indica Intermediate	786	73.20%	18.10%	0.76%	8.02%	NA
Temperate Japonica	767	0.30%	97.40%	0.00%	2.35%	NA
Tropical Japonica	504	1.20%	35.90%	1.79%	61.11%	NA
Japonica Intermediate	241	2.10%	42.30%	0.41%	55.19%	NA
VI/Aromatic	96	9.40%	74.00%	3.12%	13.54%	NA
Intermediate	90	25.60%	62.20%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418069623	G -> DEL	N	N	silent_mutation	Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N
vg0418069623	G -> A	LOC_Os04g30260.1	upstream_gene_variant ; 4823.0bp to feature; MODIFIER	silent_mutation	Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N
vg0418069623	G -> A	LOC_Os04g30270.1	intron_variant ; MODIFIER	silent_mutation	Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418069623	NA	6.65E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623	3.35E-06	9.12E-09	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623	7.67E-06	2.10E-07	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623	NA	3.14E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623	NA	2.94E-06	mr1621_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623	8.11E-06	6.02E-08	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251