\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418069623:

Variant ID: vg0418069623 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18069623
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCCCAACTACTCCCAGATGGTGGCACGGATGAAACCATAGTGTTTTCACTCCAACTAACTACTCCTAGCTAGCGGTGTTCCACAGTTGCGGCGGTGGC[G/A]
TCCCCACCCCGGTAGCTATGACGTTCCCACCCGAGCGGCGGTAGCGCGGTGTGGATCAAGGTGCTCGATGGCATCCCCACCCAGGCTGTGGTGGCATGGC

Reverse complement sequence

GCCATGCCACCACAGCCTGGGTGGGGATGCCATCGAGCACCTTGATCCACACCGCGCTACCGCCGCTCGGGTGGGAACGTCATAGCTACCGGGGTGGGGA[C/T]
GCCACCGCCGCAACTGTGGAACACCGCTAGCTAGGAGTAGTTAGTTGGAGTGAAAACACTATGGTTTCATCCGTGCCACCATCTGGGAGTAGTTGGGGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 39.20% 0.66% 16.46% NA
All Indica  2759 69.00% 20.00% 0.62% 10.33% NA
All Japonica  1512 0.90% 68.10% 0.66% 30.36% NA
Aus  269 42.00% 53.90% 0.37% 3.72% NA
Indica I  595 62.20% 36.30% 0.34% 1.18% NA
Indica II  465 54.00% 38.30% 0.65% 7.10% NA
Indica III  913 77.70% 1.80% 0.66% 19.93% NA
Indica Intermediate  786 73.20% 18.10% 0.76% 8.02% NA
Temperate Japonica  767 0.30% 97.40% 0.00% 2.35% NA
Tropical Japonica  504 1.20% 35.90% 1.79% 61.11% NA
Japonica Intermediate  241 2.10% 42.30% 0.41% 55.19% NA
VI/Aromatic  96 9.40% 74.00% 3.12% 13.54% NA
Intermediate  90 25.60% 62.20% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418069623 G -> DEL N N silent_mutation Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg0418069623 G -> A LOC_Os04g30260.1 upstream_gene_variant ; 4823.0bp to feature; MODIFIER silent_mutation Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg0418069623 G -> A LOC_Os04g30270.1 intron_variant ; MODIFIER silent_mutation Average:60.081; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418069623 NA 6.65E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623 3.35E-06 9.12E-09 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623 7.67E-06 2.10E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623 NA 3.14E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623 NA 2.94E-06 mr1621_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418069623 8.11E-06 6.02E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251