\
| Variant ID: vg0418051899 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18051899 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCATGGATGTGATCTATTGTAATTGTATCTTTATTAGTTTTGAACTAACTGTCCTATCATACAATGTTAGTGTTGATCTCTTAGAAATTCCCCTAGGAA[T/C]
ACGTGGAGGTATCAACTAGTTAAGAATGATGTGTATAGTTTTGGAGTAACTTTGGTTGAACATCTGACCGGTAAAAGGCCACTGTCTAAAGAAACGAAGA
TCTTCGTTTCTTTAGACAGTGGCCTTTTACCGGTCAGATGTTCAACCAAAGTTACTCCAAAACTATACACATCATTCTTAACTAGTTGATACCTCCACGT[A/G]
TTCCTAGGGGAATTTCTAAGAGATCAACACTAACATTGTATGATAGGACAGTTAGTTCAAAACTAATAAAGATACAATTACAATAGATCACATCCATGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 12.20% | 1.46% | 26.56% | NA |
| All Indica | 2759 | 52.70% | 1.30% | 2.10% | 43.89% | NA |
| All Japonica | 1512 | 64.90% | 33.00% | 0.33% | 1.79% | NA |
| Aus | 269 | 96.30% | 0.00% | 2.23% | 1.49% | NA |
| Indica I | 595 | 96.00% | 0.50% | 0.34% | 3.19% | NA |
| Indica II | 465 | 47.70% | 4.30% | 1.94% | 46.02% | NA |
| Indica III | 913 | 27.50% | 0.20% | 2.74% | 69.55% | NA |
| Indica Intermediate | 786 | 52.00% | 1.50% | 2.80% | 43.64% | NA |
| Temperate Japonica | 767 | 96.20% | 2.60% | 0.39% | 0.78% | NA |
| Tropical Japonica | 504 | 29.40% | 66.50% | 0.20% | 3.97% | NA |
| Japonica Intermediate | 241 | 39.40% | 59.80% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 20.00% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418051899 | T -> C | LOC_Os04g30240.1 | upstream_gene_variant ; 2461.0bp to feature; MODIFIER | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| vg0418051899 | T -> C | LOC_Os04g30250.1 | downstream_gene_variant ; 1236.0bp to feature; MODIFIER | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| vg0418051899 | T -> C | LOC_Os04g30250.2 | downstream_gene_variant ; 1217.0bp to feature; MODIFIER | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| vg0418051899 | T -> C | LOC_Os04g30250.3 | downstream_gene_variant ; 1217.0bp to feature; MODIFIER | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| vg0418051899 | T -> C | LOC_Os04g30240-LOC_Os04g30250 | intergenic_region ; MODIFIER | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| vg0418051899 | T -> DEL | N | N | silent_mutation | Average:23.278; most accessible tissue: Callus, score: 55.777 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418051899 | 4.17E-17 | 6.36E-45 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 4.15E-06 | 5.54E-24 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 8.98E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.49E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 4.73E-13 | 6.24E-29 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.63E-15 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 6.30E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.41E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.13E-13 | mr1533 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 9.99E-09 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 9.77E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 5.91E-07 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 4.12E-23 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.20E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.17E-30 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.42E-16 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.24E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 8.83E-08 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 4.01E-06 | 6.31E-16 | mr1980 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 1.36E-07 | 2.06E-12 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 4.91E-11 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 2.42E-12 | 3.29E-43 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.13E-20 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 9.32E-10 | 8.29E-29 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 1.98E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 8.16E-13 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.03E-29 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 4.57E-18 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 9.91E-09 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 8.93E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.59E-20 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | 1.98E-06 | 1.38E-19 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418051899 | NA | 2.64E-13 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |