\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418051899:

Variant ID: vg0418051899 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18051899
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCATGGATGTGATCTATTGTAATTGTATCTTTATTAGTTTTGAACTAACTGTCCTATCATACAATGTTAGTGTTGATCTCTTAGAAATTCCCCTAGGAA[T/C]
ACGTGGAGGTATCAACTAGTTAAGAATGATGTGTATAGTTTTGGAGTAACTTTGGTTGAACATCTGACCGGTAAAAGGCCACTGTCTAAAGAAACGAAGA

Reverse complement sequence

TCTTCGTTTCTTTAGACAGTGGCCTTTTACCGGTCAGATGTTCAACCAAAGTTACTCCAAAACTATACACATCATTCTTAACTAGTTGATACCTCCACGT[A/G]
TTCCTAGGGGAATTTCTAAGAGATCAACACTAACATTGTATGATAGGACAGTTAGTTCAAAACTAATAAAGATACAATTACAATAGATCACATCCATGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 12.20% 1.46% 26.56% NA
All Indica  2759 52.70% 1.30% 2.10% 43.89% NA
All Japonica  1512 64.90% 33.00% 0.33% 1.79% NA
Aus  269 96.30% 0.00% 2.23% 1.49% NA
Indica I  595 96.00% 0.50% 0.34% 3.19% NA
Indica II  465 47.70% 4.30% 1.94% 46.02% NA
Indica III  913 27.50% 0.20% 2.74% 69.55% NA
Indica Intermediate  786 52.00% 1.50% 2.80% 43.64% NA
Temperate Japonica  767 96.20% 2.60% 0.39% 0.78% NA
Tropical Japonica  504 29.40% 66.50% 0.20% 3.97% NA
Japonica Intermediate  241 39.40% 59.80% 0.41% 0.41% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 65.60% 20.00% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418051899 T -> C LOC_Os04g30240.1 upstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N
vg0418051899 T -> C LOC_Os04g30250.1 downstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N
vg0418051899 T -> C LOC_Os04g30250.2 downstream_gene_variant ; 1217.0bp to feature; MODIFIER silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N
vg0418051899 T -> C LOC_Os04g30250.3 downstream_gene_variant ; 1217.0bp to feature; MODIFIER silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N
vg0418051899 T -> C LOC_Os04g30240-LOC_Os04g30250 intergenic_region ; MODIFIER silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N
vg0418051899 T -> DEL N N silent_mutation Average:23.278; most accessible tissue: Callus, score: 55.777 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418051899 4.17E-17 6.36E-45 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 4.15E-06 5.54E-24 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 8.98E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.49E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 4.73E-13 6.24E-29 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.63E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 6.30E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.41E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.13E-13 mr1533 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 9.99E-09 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 9.77E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 5.91E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 4.12E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.20E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.17E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.42E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.24E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 8.83E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 4.01E-06 6.31E-16 mr1980 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 1.36E-07 2.06E-12 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 4.91E-11 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 2.42E-12 3.29E-43 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.13E-20 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 9.32E-10 8.29E-29 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 1.98E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 8.16E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.03E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 4.57E-18 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 9.91E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 8.93E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.59E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 1.98E-06 1.38E-19 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418051899 NA 2.64E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251