| Variant ID: vg0418016156 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 18016156 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAACAGGATGACAGAGCGAATCCGGGCGTTGGCTCATCGATCCAACGGCTATAACATGCTCCGACTGCTAAAGTTGCAGTCGTTACTGCTACAACACCA[T/G]
ATCTCAATTCGAATATGTCATATTATACTCTAATCTATAGTACTTGGATTATGACCTATGGGACAATTTTTTATGGGAAAAAAGTCCGTGTTACACCTAG
CTAGGTGTAACACGGACTTTTTTCCCATAAAAAATTGTCCCATAGGTCATAATCCAAGTACTATAGATTAGAGTATAATATGACATATTCGAATTGAGAT[A/C]
TGGTGTTGTAGCAGTAACGACTGCAACTTTAGCAGTCGGAGCATGTTATAGCCGTTGGATCGATGAGCCAACGCCCGGATTCGCTCTGTCATCCTGTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.80% | 5.60% | 4.42% | 55.10% | NA |
| All Indica | 2759 | 37.20% | 0.90% | 3.19% | 58.72% | NA |
| All Japonica | 1512 | 21.10% | 12.90% | 5.75% | 60.25% | NA |
| Aus | 269 | 90.70% | 1.10% | 5.95% | 2.23% | NA |
| Indica I | 595 | 79.20% | 1.20% | 8.24% | 11.43% | NA |
| Indica II | 465 | 8.80% | 2.20% | 1.51% | 87.53% | NA |
| Indica III | 913 | 25.50% | 0.30% | 1.20% | 72.95% | NA |
| Indica Intermediate | 786 | 35.90% | 0.50% | 2.67% | 60.94% | NA |
| Temperate Japonica | 767 | 20.60% | 18.10% | 9.52% | 51.76% | NA |
| Tropical Japonica | 504 | 20.80% | 7.50% | 1.59% | 70.04% | NA |
| Japonica Intermediate | 241 | 23.20% | 7.50% | 2.49% | 66.80% | NA |
| VI/Aromatic | 96 | 26.00% | 44.80% | 4.17% | 25.00% | NA |
| Intermediate | 90 | 34.40% | 2.20% | 15.56% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0418016156 | T -> DEL | N | N | silent_mutation | Average:20.882; most accessible tissue: Callus, score: 46.015 | N | N | N | N |
| vg0418016156 | T -> G | LOC_Os04g30170.1 | upstream_gene_variant ; 4285.0bp to feature; MODIFIER | silent_mutation | Average:20.882; most accessible tissue: Callus, score: 46.015 | N | N | N | N |
| vg0418016156 | T -> G | LOC_Os04g30180.1 | downstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:20.882; most accessible tissue: Callus, score: 46.015 | N | N | N | N |
| vg0418016156 | T -> G | LOC_Os04g30190.1 | downstream_gene_variant ; 1024.0bp to feature; MODIFIER | silent_mutation | Average:20.882; most accessible tissue: Callus, score: 46.015 | N | N | N | N |
| vg0418016156 | T -> G | LOC_Os04g30180-LOC_Os04g30190 | intergenic_region ; MODIFIER | silent_mutation | Average:20.882; most accessible tissue: Callus, score: 46.015 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0418016156 | 1.01E-13 | 1.45E-27 | Awn_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0418016156 | NA | 3.83E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0418016156 | NA | 1.08E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418016156 | NA | 1.04E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418016156 | NA | 8.62E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418016156 | NA | 8.78E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0418016156 | NA | 5.66E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/