\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417919001:

Variant ID: vg0417919001 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17919001
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATATATTAGAGTTATGGAGCTGGGTTTAGGCAACTCCATAACTCCACTCCAGACCTAACTCCTGGAGTAATATTTAGGAGTTGGAGCTGTATCAAA[C/T]
AGCCCTTAAATAAATCCTATGTAGAAAAGTTTTGACATGGTGAAAAAGTTAAAAGTTTAAGGAAAAAGTTTAGAGCAGTAACTAAACCAGGCCTAAACAC

Reverse complement sequence

GTGTTTAGGCCTGGTTTAGTTACTGCTCTAAACTTTTTCCTTAAACTTTTAACTTTTTCACCATGTCAAAACTTTTCTACATAGGATTTATTTAAGGGCT[G/A]
TTTGATACAGCTCCAACTCCTAAATATTACTCCAGGAGTTAGGTCTGGAGTGGAGTTATGGAGTTGCCTAAACCCAGCTCCATAACTCTAATATATTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 4.90% 3.60% 41.05% NA
All Indica  2759 37.90% 3.50% 2.46% 56.07% NA
All Japonica  1512 61.00% 8.50% 6.22% 24.21% NA
Aus  269 98.50% 0.40% 0.37% 0.74% NA
Indica I  595 67.70% 13.90% 7.23% 11.09% NA
Indica II  465 18.30% 0.40% 2.15% 79.14% NA
Indica III  913 27.90% 0.00% 0.88% 71.19% NA
Indica Intermediate  786 38.70% 1.50% 0.89% 58.91% NA
Temperate Japonica  767 29.50% 14.60% 11.21% 44.72% NA
Tropical Japonica  504 98.40% 0.40% 0.20% 0.99% NA
Japonica Intermediate  241 83.40% 6.20% 2.90% 7.47% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 62.20% 3.30% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417919001 C -> DEL N N silent_mutation Average:15.213; most accessible tissue: Callus, score: 98.003 N N N N
vg0417919001 C -> T LOC_Os04g30030.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:15.213; most accessible tissue: Callus, score: 98.003 N N N N
vg0417919001 C -> T LOC_Os04g30030-LOC_Os04g30040 intergenic_region ; MODIFIER silent_mutation Average:15.213; most accessible tissue: Callus, score: 98.003 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417919001 NA 1.98E-07 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 7.64E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 8.35E-08 mr1510 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 2.71E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 4.12E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 5.98E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 2.21E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 7.86E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 9.61E-06 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 3.40E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 1.49E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 8.92E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 6.64E-09 mr1510_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 7.07E-06 7.05E-06 mr1569_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 3.34E-08 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 5.80E-09 mr1702_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 9.77E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 2.86E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417919001 NA 1.01E-06 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251