Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417900657:

Variant ID: vg0417900657 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17900657
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATGTAAAACTTAAGAAACCAGAAGAGATCGTCGATGCCTTGATGATTGAATATGTTCTTTATTACTCAAGTATTGTTCACAGGGTGCAGCCACAGCA[C/T]
GTTAGCACCCCTCACAAGTTTCTCACGAAACCCTATCTAATCTCTCAAACATGGTTTTACTCAAGGCATAGTCTCCCTCCCTATTTATACCGAATATCTC

Reverse complement sequence

GAGATATTCGGTATAAATAGGGAGGGAGACTATGCCTTGAGTAAAACCATGTTTGAGAGATTAGATAGGGTTTCGTGAGAAACTTGTGAGGGGTGCTAAC[G/A]
TGCTGTGGCTGCACCCTGTGAACAATACTTGAGTAATAAAGAACATATTCAATCATCAAGGCATCGACGATCTCTTCTGGTTTCTTAAGTTTTACATTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	4.70%	2.96%	11.26%	NA
All Indica	2759	87.40%	7.70%	3.73%	1.12%	NA
All Japonica	1512	66.90%	0.30%	1.79%	31.08%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	74.50%	12.30%	12.77%	0.50%	NA
Indica II	465	94.40%	0.60%	1.08%	3.87%	NA
Indica III	913	93.00%	6.70%	0.11%	0.22%	NA
Indica Intermediate	786	86.60%	9.70%	2.67%	1.02%	NA
Temperate Japonica	767	97.00%	0.00%	0.78%	2.22%	NA
Tropical Japonica	504	33.90%	0.20%	2.58%	63.29%	NA
Japonica Intermediate	241	39.80%	1.20%	3.32%	55.60%	NA
VI/Aromatic	96	80.20%	0.00%	2.08%	17.71%	NA
Intermediate	90	72.20%	5.60%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417900657	C -> DEL	N	N	silent_mutation	Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0417900657	C -> T	LOC_Os04g30000.1	upstream_gene_variant ; 3267.0bp to feature; MODIFIER	silent_mutation	Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0417900657	C -> T	LOC_Os04g29990-LOC_Os04g30000	intergenic_region ; MODIFIER	silent_mutation	Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417900657	NA	2.69E-11	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	NA	2.02E-06	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	NA	1.55E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	2.14E-06	2.18E-11	mr1860	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	NA	3.38E-08	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	NA	3.05E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657	NA	2.80E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251