\
| Variant ID: vg0417900657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17900657 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAATGTAAAACTTAAGAAACCAGAAGAGATCGTCGATGCCTTGATGATTGAATATGTTCTTTATTACTCAAGTATTGTTCACAGGGTGCAGCCACAGCA[C/T]
GTTAGCACCCCTCACAAGTTTCTCACGAAACCCTATCTAATCTCTCAAACATGGTTTTACTCAAGGCATAGTCTCCCTCCCTATTTATACCGAATATCTC
GAGATATTCGGTATAAATAGGGAGGGAGACTATGCCTTGAGTAAAACCATGTTTGAGAGATTAGATAGGGTTTCGTGAGAAACTTGTGAGGGGTGCTAAC[G/A]
TGCTGTGGCTGCACCCTGTGAACAATACTTGAGTAATAAAGAACATATTCAATCATCAAGGCATCGACGATCTCTTCTGGTTTCTTAAGTTTTACATTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.10% | 4.70% | 2.96% | 11.26% | NA |
| All Indica | 2759 | 87.40% | 7.70% | 3.73% | 1.12% | NA |
| All Japonica | 1512 | 66.90% | 0.30% | 1.79% | 31.08% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 74.50% | 12.30% | 12.77% | 0.50% | NA |
| Indica II | 465 | 94.40% | 0.60% | 1.08% | 3.87% | NA |
| Indica III | 913 | 93.00% | 6.70% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 86.60% | 9.70% | 2.67% | 1.02% | NA |
| Temperate Japonica | 767 | 97.00% | 0.00% | 0.78% | 2.22% | NA |
| Tropical Japonica | 504 | 33.90% | 0.20% | 2.58% | 63.29% | NA |
| Japonica Intermediate | 241 | 39.80% | 1.20% | 3.32% | 55.60% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 72.20% | 5.60% | 6.67% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417900657 | C -> DEL | N | N | silent_mutation | Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0417900657 | C -> T | LOC_Os04g30000.1 | upstream_gene_variant ; 3267.0bp to feature; MODIFIER | silent_mutation | Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0417900657 | C -> T | LOC_Os04g29990-LOC_Os04g30000 | intergenic_region ; MODIFIER | silent_mutation | Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417900657 | NA | 2.69E-11 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | NA | 2.02E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | NA | 1.55E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | 2.14E-06 | 2.18E-11 | mr1860 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | NA | 3.38E-08 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | NA | 3.05E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417900657 | NA | 2.80E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |