\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417900657:

Variant ID: vg0417900657 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17900657
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATGTAAAACTTAAGAAACCAGAAGAGATCGTCGATGCCTTGATGATTGAATATGTTCTTTATTACTCAAGTATTGTTCACAGGGTGCAGCCACAGCA[C/T]
GTTAGCACCCCTCACAAGTTTCTCACGAAACCCTATCTAATCTCTCAAACATGGTTTTACTCAAGGCATAGTCTCCCTCCCTATTTATACCGAATATCTC

Reverse complement sequence

GAGATATTCGGTATAAATAGGGAGGGAGACTATGCCTTGAGTAAAACCATGTTTGAGAGATTAGATAGGGTTTCGTGAGAAACTTGTGAGGGGTGCTAAC[G/A]
TGCTGTGGCTGCACCCTGTGAACAATACTTGAGTAATAAAGAACATATTCAATCATCAAGGCATCGACGATCTCTTCTGGTTTCTTAAGTTTTACATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 4.70% 2.96% 11.26% NA
All Indica  2759 87.40% 7.70% 3.73% 1.12% NA
All Japonica  1512 66.90% 0.30% 1.79% 31.08% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 74.50% 12.30% 12.77% 0.50% NA
Indica II  465 94.40% 0.60% 1.08% 3.87% NA
Indica III  913 93.00% 6.70% 0.11% 0.22% NA
Indica Intermediate  786 86.60% 9.70% 2.67% 1.02% NA
Temperate Japonica  767 97.00% 0.00% 0.78% 2.22% NA
Tropical Japonica  504 33.90% 0.20% 2.58% 63.29% NA
Japonica Intermediate  241 39.80% 1.20% 3.32% 55.60% NA
VI/Aromatic  96 80.20% 0.00% 2.08% 17.71% NA
Intermediate  90 72.20% 5.60% 6.67% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417900657 C -> DEL N N silent_mutation Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0417900657 C -> T LOC_Os04g30000.1 upstream_gene_variant ; 3267.0bp to feature; MODIFIER silent_mutation Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0417900657 C -> T LOC_Os04g29990-LOC_Os04g30000 intergenic_region ; MODIFIER silent_mutation Average:39.028; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417900657 NA 2.69E-11 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 NA 2.02E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 NA 1.55E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 2.14E-06 2.18E-11 mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 NA 3.38E-08 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 NA 3.05E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417900657 NA 2.80E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251