\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417867500:

Variant ID: vg0417867500 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17867500
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATGACCTAATGATAATTGTAACCATTTGTTTGGTCAAATCTGCTATTGAAAAATGATTAGTTTCAGTTTTTTATGAACCAAGAAACCCCTTATGCAT[C/G,T]
TGATGGCGATGATTTTATCAATAGTATCATTTACCTGTATAACTGACTCTGCATCCTCAGCTCTACAATTTGCTTGTATTTGTTCGATTTCAGCTGATGT

Reverse complement sequence

ACATCAGCTGAAATCGAACAAATACAAGCAAATTGTAGAGCTGAGGATGCAGAGTCAGTTATACAGGTAAATGATACTATTGATAAAATCATCGCCATCA[G/C,A]
ATGCATAAGGGGTTTCTTGGTTCATAAAAAACTGAAACTAATCATTTTTCAATAGCAGATTTGACCAAACAAATGGTTACAATTATCATTAGGTCATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.10% 14.00% 2.37% 53.45% G: 0.13%
All Indica  2759 35.40% 7.30% 2.17% 55.02% G: 0.07%
All Japonica  1512 12.60% 28.40% 2.58% 56.28% G: 0.07%
Aus  269 64.70% 0.40% 2.23% 31.60% G: 1.12%
Indica I  595 68.10% 1.80% 1.34% 28.74% NA
Indica II  465 13.80% 7.30% 3.87% 74.84% G: 0.22%
Indica III  913 25.00% 8.90% 1.31% 64.84% NA
Indica Intermediate  786 35.80% 9.50% 2.80% 51.78% G: 0.13%
Temperate Japonica  767 11.30% 13.00% 3.39% 72.23% NA
Tropical Japonica  504 16.70% 48.00% 1.59% 33.73% NA
Japonica Intermediate  241 8.30% 36.50% 2.07% 52.70% G: 0.41%
VI/Aromatic  96 51.00% 7.30% 4.17% 37.50% NA
Intermediate  90 33.30% 23.30% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417867500 C -> DEL N N silent_mutation Average:12.72; most accessible tissue: Callus, score: 91.294 N N N N
vg0417867500 C -> G LOC_Os04g29940.1 downstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:12.72; most accessible tissue: Callus, score: 91.294 N N N N
vg0417867500 C -> G LOC_Os04g29950.1 intron_variant ; MODIFIER silent_mutation Average:12.72; most accessible tissue: Callus, score: 91.294 N N N N
vg0417867500 C -> T LOC_Os04g29940.1 downstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:12.72; most accessible tissue: Callus, score: 91.294 N N N N
vg0417867500 C -> T LOC_Os04g29950.1 intron_variant ; MODIFIER silent_mutation Average:12.72; most accessible tissue: Callus, score: 91.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417867500 NA 4.35E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417867500 NA 8.28E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417867500 NA 4.85E-08 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417867500 NA 2.69E-06 mr1942 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251