\
| Variant ID: vg0417867500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17867500 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGATGACCTAATGATAATTGTAACCATTTGTTTGGTCAAATCTGCTATTGAAAAATGATTAGTTTCAGTTTTTTATGAACCAAGAAACCCCTTATGCAT[C/G,T]
TGATGGCGATGATTTTATCAATAGTATCATTTACCTGTATAACTGACTCTGCATCCTCAGCTCTACAATTTGCTTGTATTTGTTCGATTTCAGCTGATGT
ACATCAGCTGAAATCGAACAAATACAAGCAAATTGTAGAGCTGAGGATGCAGAGTCAGTTATACAGGTAAATGATACTATTGATAAAATCATCGCCATCA[G/C,A]
ATGCATAAGGGGTTTCTTGGTTCATAAAAAACTGAAACTAATCATTTTTCAATAGCAGATTTGACCAAACAAATGGTTACAATTATCATTAGGTCATCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.10% | 14.00% | 2.37% | 53.45% | G: 0.13% |
| All Indica | 2759 | 35.40% | 7.30% | 2.17% | 55.02% | G: 0.07% |
| All Japonica | 1512 | 12.60% | 28.40% | 2.58% | 56.28% | G: 0.07% |
| Aus | 269 | 64.70% | 0.40% | 2.23% | 31.60% | G: 1.12% |
| Indica I | 595 | 68.10% | 1.80% | 1.34% | 28.74% | NA |
| Indica II | 465 | 13.80% | 7.30% | 3.87% | 74.84% | G: 0.22% |
| Indica III | 913 | 25.00% | 8.90% | 1.31% | 64.84% | NA |
| Indica Intermediate | 786 | 35.80% | 9.50% | 2.80% | 51.78% | G: 0.13% |
| Temperate Japonica | 767 | 11.30% | 13.00% | 3.39% | 72.23% | NA |
| Tropical Japonica | 504 | 16.70% | 48.00% | 1.59% | 33.73% | NA |
| Japonica Intermediate | 241 | 8.30% | 36.50% | 2.07% | 52.70% | G: 0.41% |
| VI/Aromatic | 96 | 51.00% | 7.30% | 4.17% | 37.50% | NA |
| Intermediate | 90 | 33.30% | 23.30% | 3.33% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417867500 | C -> DEL | N | N | silent_mutation | Average:12.72; most accessible tissue: Callus, score: 91.294 | N | N | N | N |
| vg0417867500 | C -> G | LOC_Os04g29940.1 | downstream_gene_variant ; 3367.0bp to feature; MODIFIER | silent_mutation | Average:12.72; most accessible tissue: Callus, score: 91.294 | N | N | N | N |
| vg0417867500 | C -> G | LOC_Os04g29950.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.72; most accessible tissue: Callus, score: 91.294 | N | N | N | N |
| vg0417867500 | C -> T | LOC_Os04g29940.1 | downstream_gene_variant ; 3367.0bp to feature; MODIFIER | silent_mutation | Average:12.72; most accessible tissue: Callus, score: 91.294 | N | N | N | N |
| vg0417867500 | C -> T | LOC_Os04g29950.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.72; most accessible tissue: Callus, score: 91.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417867500 | NA | 4.35E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417867500 | NA | 8.28E-06 | mr1835 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417867500 | NA | 4.85E-08 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417867500 | NA | 2.69E-06 | mr1942 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |