\
| Variant ID: vg0417840360 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17840360 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )
GCTGGTCCGAGTCCGACCCTGTTTCGTCGGGTCTCGAGGTTTCCTTGCTCGGGAAGGCATGTTTTGGGTTTCCTTTGGTTTCTACCCCGAGTTGGACGTG[G/A]
AGGAGGGCCTGTAGAGGGCAAGACCAACCCCTGTATAAGGGACAAGGCCGGTTCATTGTAAAATCAATCTACTATCAATCAATCGAATCGTTCTTTTCAT
ATGAAAAGAACGATTCGATTGATTGATAGTAGATTGATTTTACAATGAACCGGCCTTGTCCCTTATACAGGGGTTGGTCTTGCCCTCTACAGGCCCTCCT[C/T]
CACGTCCAACTCGGGGTAGAAACCAAAGGAAACCCAAAACATGCCTTCCCGAGCAAGGAAACCTCGAGACCCGACGAAACAGGGTCGGACTCGGACCAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.70% | 12.80% | 1.76% | 49.75% | NA |
| All Indica | 2759 | 41.80% | 1.30% | 2.32% | 54.62% | NA |
| All Japonica | 1512 | 16.30% | 34.50% | 0.86% | 48.35% | NA |
| Aus | 269 | 69.50% | 0.00% | 0.74% | 29.74% | NA |
| Indica I | 595 | 73.80% | 0.30% | 1.01% | 24.87% | NA |
| Indica II | 465 | 24.30% | 4.50% | 4.52% | 66.67% | NA |
| Indica III | 913 | 27.30% | 0.20% | 1.31% | 71.19% | NA |
| Indica Intermediate | 786 | 44.70% | 1.40% | 3.18% | 50.76% | NA |
| Temperate Japonica | 767 | 14.30% | 3.30% | 1.43% | 80.96% | NA |
| Tropical Japonica | 504 | 22.20% | 68.80% | 0.00% | 8.93% | NA |
| Japonica Intermediate | 241 | 10.00% | 62.20% | 0.83% | 26.97% | NA |
| VI/Aromatic | 96 | 63.50% | 30.20% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 44.40% | 21.10% | 3.33% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417840360 | G -> DEL | N | N | silent_mutation | Average:20.37; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0417840360 | G -> A | LOC_Os04g29920.1 | downstream_gene_variant ; 458.0bp to feature; MODIFIER | silent_mutation | Average:20.37; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0417840360 | G -> A | LOC_Os04g29920-LOC_Os04g29930 | intergenic_region ; MODIFIER | silent_mutation | Average:20.37; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417840360 | NA | 3.95E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 8.00E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 2.00E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 8.69E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 3.36E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | 3.20E-06 | NA | mr1663_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 6.53E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 2.16E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 5.42E-06 | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 4.21E-12 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | NA | 3.19E-16 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417840360 | 6.32E-06 | 6.31E-06 | mr1983_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |