\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417758175:

Variant ID: vg0417758175 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17758175
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGACGAACTCGCCCTCGATGGGAGTAACTACCCAATTTGGGCTTCCGATATCAAAATAATTTTTTCTTCTAGTGGGATTTCACATACAAATTAGGAACC[C/T]
AATGATTGGGATCCACCAGTTAAGAATAGAAAGCTATATATTGCCTTTTTCCTTCTAAGGCTCTACATCTATAAAGATCTCAAACATGAGTACATGTTGG

Reverse complement sequence

CCAACATGTACTCATGTTTGAGATCTTTATAGATGTAGAGCCTTAGAAGGAAAAAGGCAATATATAGCTTTCTATTCTTAACTGGTGGATCCCAATCATT[G/A]
GGTTCCTAATTTGTATGTGAAATCCCACTAGAAGAAAAAATTATTTTGATATCGGAAGCCCAAATTGGGTAGTTACTCCCATCGAGGGCGAGTTCGTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 21.30% 3.32% 42.57% NA
All Indica  2759 37.40% 32.90% 2.54% 27.22% NA
All Japonica  1512 16.60% 2.10% 4.63% 76.65% NA
Aus  269 65.40% 16.70% 3.35% 14.50% NA
Indica I  595 67.60% 18.70% 2.02% 11.76% NA
Indica II  465 17.20% 43.20% 5.38% 34.19% NA
Indica III  913 26.60% 38.90% 1.64% 32.86% NA
Indica Intermediate  786 38.90% 30.50% 2.29% 28.24% NA
Temperate Japonica  767 11.20% 3.50% 3.91% 81.36% NA
Tropical Japonica  504 26.20% 0.40% 5.36% 68.06% NA
Japonica Intermediate  241 13.70% 1.20% 5.39% 79.67% NA
VI/Aromatic  96 60.40% 2.10% 1.04% 36.46% NA
Intermediate  90 36.70% 24.40% 7.78% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417758175 C -> DEL N N silent_mutation Average:9.722; most accessible tissue: Callus, score: 44.855 N N N N
vg0417758175 C -> T LOC_Os04g29790.1 upstream_gene_variant ; 1666.0bp to feature; MODIFIER silent_mutation Average:9.722; most accessible tissue: Callus, score: 44.855 N N N N
vg0417758175 C -> T LOC_Os04g29800.1 upstream_gene_variant ; 430.0bp to feature; MODIFIER silent_mutation Average:9.722; most accessible tissue: Callus, score: 44.855 N N N N
vg0417758175 C -> T LOC_Os04g29790-LOC_Os04g29800 intergenic_region ; MODIFIER silent_mutation Average:9.722; most accessible tissue: Callus, score: 44.855 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417758175 3.08E-06 3.27E-06 mr1748_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417758175 NA 7.23E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417758175 NA 7.23E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251