\
| Variant ID: vg0417758175 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17758175 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGACGAACTCGCCCTCGATGGGAGTAACTACCCAATTTGGGCTTCCGATATCAAAATAATTTTTTCTTCTAGTGGGATTTCACATACAAATTAGGAACC[C/T]
AATGATTGGGATCCACCAGTTAAGAATAGAAAGCTATATATTGCCTTTTTCCTTCTAAGGCTCTACATCTATAAAGATCTCAAACATGAGTACATGTTGG
CCAACATGTACTCATGTTTGAGATCTTTATAGATGTAGAGCCTTAGAAGGAAAAAGGCAATATATAGCTTTCTATTCTTAACTGGTGGATCCCAATCATT[G/A]
GGTTCCTAATTTGTATGTGAAATCCCACTAGAAGAAAAAATTATTTTGATATCGGAAGCCCAAATTGGGTAGTTACTCCCATCGAGGGCGAGTTCGTCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 21.30% | 3.32% | 42.57% | NA |
| All Indica | 2759 | 37.40% | 32.90% | 2.54% | 27.22% | NA |
| All Japonica | 1512 | 16.60% | 2.10% | 4.63% | 76.65% | NA |
| Aus | 269 | 65.40% | 16.70% | 3.35% | 14.50% | NA |
| Indica I | 595 | 67.60% | 18.70% | 2.02% | 11.76% | NA |
| Indica II | 465 | 17.20% | 43.20% | 5.38% | 34.19% | NA |
| Indica III | 913 | 26.60% | 38.90% | 1.64% | 32.86% | NA |
| Indica Intermediate | 786 | 38.90% | 30.50% | 2.29% | 28.24% | NA |
| Temperate Japonica | 767 | 11.20% | 3.50% | 3.91% | 81.36% | NA |
| Tropical Japonica | 504 | 26.20% | 0.40% | 5.36% | 68.06% | NA |
| Japonica Intermediate | 241 | 13.70% | 1.20% | 5.39% | 79.67% | NA |
| VI/Aromatic | 96 | 60.40% | 2.10% | 1.04% | 36.46% | NA |
| Intermediate | 90 | 36.70% | 24.40% | 7.78% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417758175 | C -> DEL | N | N | silent_mutation | Average:9.722; most accessible tissue: Callus, score: 44.855 | N | N | N | N |
| vg0417758175 | C -> T | LOC_Os04g29790.1 | upstream_gene_variant ; 1666.0bp to feature; MODIFIER | silent_mutation | Average:9.722; most accessible tissue: Callus, score: 44.855 | N | N | N | N |
| vg0417758175 | C -> T | LOC_Os04g29800.1 | upstream_gene_variant ; 430.0bp to feature; MODIFIER | silent_mutation | Average:9.722; most accessible tissue: Callus, score: 44.855 | N | N | N | N |
| vg0417758175 | C -> T | LOC_Os04g29790-LOC_Os04g29800 | intergenic_region ; MODIFIER | silent_mutation | Average:9.722; most accessible tissue: Callus, score: 44.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417758175 | 3.08E-06 | 3.27E-06 | mr1748_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417758175 | NA | 7.23E-07 | mr1946_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417758175 | NA | 7.23E-07 | mr1948_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |