Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0417719148:

Variant ID: vg0417719148 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17719148
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCGGGGATTTTGCAGATGAGGAGGGCCCCTGGCATGGGCGCACAACGGTGGGGCATTGGTGAGGTGGCTGTATGTTCAAGGTGCTCAAATAGTGGTA[G/A]
CTGCAGGTAGGACCGTAGGAAGATCTCTGGGTGAAAGCCTAGTCCGTCCAGGGCCGATAGTGGTGACGCTTTCGAGCGACAACCCTCCTAGGGGTATTGT

Reverse complement sequence

ACAATACCCCTAGGAGGGTTGTCGCTCGAAAGCGTCACCACTATCGGCCCTGGACGGACTAGGCTTTCACCCAGAGATCTTCCTACGGTCCTACCTGCAG[C/T]
TACCACTATTTGAGCACCTTGAACATACAGCCACCTCACCAATGCCCCACCGTTGTGCGCCCATGCCAGGGGCCCTCCTCATCTGCAAAATCCCCGCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 13.20% 0.49% 28.84% NA
All Indica  2759 52.30% 1.50% 0.58% 45.63% NA
All Japonica  1512 65.00% 34.60% 0.20% 0.20% NA
Aus  269 66.50% 0.00% 1.12% 32.34% NA
Indica I  595 97.10% 0.50% 0.00% 2.35% NA
Indica II  465 47.50% 4.90% 1.29% 46.24% NA
Indica III  913 27.20% 0.30% 0.44% 72.07% NA
Indica Intermediate  786 50.30% 1.70% 0.76% 47.33% NA
Temperate Japonica  767 96.70% 3.10% 0.13% 0.00% NA
Tropical Japonica  504 30.00% 69.40% 0.20% 0.40% NA
Japonica Intermediate  241 37.30% 61.80% 0.41% 0.41% NA
VI/Aromatic  96 60.40% 35.40% 0.00% 4.17% NA
Intermediate  90 60.00% 27.80% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417719148 G -> DEL N N silent_mutation Average:56.907; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0417719148 G -> A LOC_Os04g29740.1 downstream_gene_variant ; 2684.0bp to feature; MODIFIER silent_mutation Average:56.907; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0417719148 G -> A LOC_Os04g29730.1 intron_variant ; MODIFIER silent_mutation Average:56.907; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417719148 NA 2.04E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 5.62E-08 1.74E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 3.12E-17 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.44E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 2.85E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.16E-12 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.69E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 2.73E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.31E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.47E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 7.34E-06 7.90E-09 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.20E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.68E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 8.92E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.05E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.08E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 7.23E-22 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.23E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.09E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.17E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 5.48E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 3.59E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 8.00E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.55E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 3.41E-07 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.88E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.00E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.46E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 4.05E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 9.81E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 1.46E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417719148 NA 6.20E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251