\
| Variant ID: vg0417713254 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 17713254 |
| Reference Allele: A | Alternative Allele: T,AC |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, A: 0.22, others allele: 0.00, population size: 68. )
AAATTAAATTTTTTAAAATATAAGGATAAAAGAAATATATAAGTGGAGGATGGGGGTCATGCAGTAGCATAGATGGTGCGGCAGTTGTTCAAACAACAAC[A/T,AC]
AAGTTGTTGTACAGGAAATGTCTCATTCAATACTACGTTGGTTTTTTCGTGTGAAGAAGCGAGTAAAGCTGCAAAACACAAATACCAGTTGTCGAGCATG
CATGCTCGACAACTGGTATTTGTGTTTTGCAGCTTTACTCGCTTCTTCACACGAAAAAACCAACGTAGTATTGAATGAGACATTTCCTGTACAACAACTT[T/A,GT]
GTTGTTGTTTGAACAACTGCCGCACCATCTATGCTACTGCATGACCCCCATCCTCCACTTATATATTTCTTTTATCCTTATATTTTAAAAAATTTAATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 29.20% | 0.70% | 28.10% | AC: 0.08% |
| All Indica | 2759 | 41.80% | 12.80% | 1.01% | 44.40% | AC: 0.04% |
| All Japonica | 1512 | 38.00% | 61.70% | 0.07% | 0.20% | AC: 0.07% |
| Aus | 269 | 63.90% | 3.00% | 0.74% | 32.34% | NA |
| Indica I | 595 | 88.20% | 9.40% | 0.00% | 2.35% | NA |
| Indica II | 465 | 15.70% | 38.10% | 1.72% | 44.52% | NA |
| Indica III | 913 | 26.70% | 1.40% | 0.66% | 71.19% | NA |
| Indica Intermediate | 786 | 39.60% | 13.50% | 1.78% | 45.04% | AC: 0.13% |
| Temperate Japonica | 767 | 51.00% | 48.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 22.20% | 77.20% | 0.00% | 0.40% | AC: 0.20% |
| Japonica Intermediate | 241 | 29.50% | 70.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 47.90% | 47.90% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 38.90% | 46.70% | 2.22% | 10.00% | AC: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417713254 | A -> DEL | N | N | silent_mutation | Average:29.254; most accessible tissue: Callus, score: 78.643 | N | N | N | N |
| vg0417713254 | A -> AC | LOC_Os04g29700-LOC_Os04g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:29.254; most accessible tissue: Callus, score: 78.643 | N | N | N | N |
| vg0417713254 | A -> T | LOC_Os04g29700-LOC_Os04g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:29.254; most accessible tissue: Callus, score: 78.643 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417713254 | NA | 2.37E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 2.29E-07 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 4.41E-08 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 1.36E-06 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 6.13E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 3.99E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 6.64E-13 | mr1195_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 9.67E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 2.76E-09 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 4.68E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417713254 | NA | 1.74E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |