\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417713254:

Variant ID: vg0417713254 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 17713254
Reference Allele: AAlternative Allele: T,AC
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, A: 0.22, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTAAATTTTTTAAAATATAAGGATAAAAGAAATATATAAGTGGAGGATGGGGGTCATGCAGTAGCATAGATGGTGCGGCAGTTGTTCAAACAACAAC[A/T,AC]
AAGTTGTTGTACAGGAAATGTCTCATTCAATACTACGTTGGTTTTTTCGTGTGAAGAAGCGAGTAAAGCTGCAAAACACAAATACCAGTTGTCGAGCATG

Reverse complement sequence

CATGCTCGACAACTGGTATTTGTGTTTTGCAGCTTTACTCGCTTCTTCACACGAAAAAACCAACGTAGTATTGAATGAGACATTTCCTGTACAACAACTT[T/A,GT]
GTTGTTGTTTGAACAACTGCCGCACCATCTATGCTACTGCATGACCCCCATCCTCCACTTATATATTTCTTTTATCCTTATATTTTAAAAAATTTAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 29.20% 0.70% 28.10% AC: 0.08%
All Indica  2759 41.80% 12.80% 1.01% 44.40% AC: 0.04%
All Japonica  1512 38.00% 61.70% 0.07% 0.20% AC: 0.07%
Aus  269 63.90% 3.00% 0.74% 32.34% NA
Indica I  595 88.20% 9.40% 0.00% 2.35% NA
Indica II  465 15.70% 38.10% 1.72% 44.52% NA
Indica III  913 26.70% 1.40% 0.66% 71.19% NA
Indica Intermediate  786 39.60% 13.50% 1.78% 45.04% AC: 0.13%
Temperate Japonica  767 51.00% 48.90% 0.13% 0.00% NA
Tropical Japonica  504 22.20% 77.20% 0.00% 0.40% AC: 0.20%
Japonica Intermediate  241 29.50% 70.10% 0.00% 0.41% NA
VI/Aromatic  96 47.90% 47.90% 0.00% 4.17% NA
Intermediate  90 38.90% 46.70% 2.22% 10.00% AC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417713254 A -> DEL N N silent_mutation Average:29.254; most accessible tissue: Callus, score: 78.643 N N N N
vg0417713254 A -> AC LOC_Os04g29700-LOC_Os04g29730 intergenic_region ; MODIFIER silent_mutation Average:29.254; most accessible tissue: Callus, score: 78.643 N N N N
vg0417713254 A -> T LOC_Os04g29700-LOC_Os04g29730 intergenic_region ; MODIFIER silent_mutation Average:29.254; most accessible tissue: Callus, score: 78.643 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417713254 NA 2.37E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 2.29E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 4.41E-08 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 1.36E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 6.13E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 3.99E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 6.64E-13 mr1195_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 9.67E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 2.76E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 4.68E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417713254 NA 1.74E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251