| Variant ID: vg0417591285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17591285 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATGGGCTGTAGGTTTCTCACACCAATTGGATGAATTAGATCTAAAAATTAGAGGAGAGCATGATTGGATTGCACGCAATTCATTGTTCAAAAGGCACA[A/G]
TTGGTTGGATAGGAGTACAATGCTGCTAAGAATAATTGTTTTCTTTTTAAATAACCTATGGCTGAAAATTATGATCTTGAATGCTAAAGGATAATGCGAT
ATCGCATTATCCTTTAGCATTCAAGATCATAATTTTCAGCCATAGGTTATTTAAAAAGAAAACAATTATTCTTAGCAGCATTGTACTCCTATCCAACCAA[T/C]
TGTGCCTTTTGAACAATGAATTGCGTGCAATCCAATCATGCTCTCCTCTAATTTTTAGATCTAATTCATCCAATTGGTGTGAGAAACCTACAGCCCATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.80% | 25.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 57.40% | 42.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417591285 | A -> G | LOC_Os04g29580.1 | downstream_gene_variant ; 1531.0bp to feature; MODIFIER | silent_mutation | Average:39.118; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| vg0417591285 | A -> G | LOC_Os04g29590.1 | downstream_gene_variant ; 2906.0bp to feature; MODIFIER | silent_mutation | Average:39.118; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| vg0417591285 | A -> G | LOC_Os04g29580-LOC_Os04g29590 | intergenic_region ; MODIFIER | silent_mutation | Average:39.118; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417591285 | NA | 4.98E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591285 | NA | 7.48E-06 | mr1066_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591285 | 6.37E-07 | NA | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591285 | NA | 5.51E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591285 | NA | 3.61E-07 | mr1807_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |