\
| Variant ID: vg0417591194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17591194 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATGAATTCACACAATAAATTGTAGGAGCCAGAGCTAGAGTAATAATAGGAAAAATAATTCATTGTATTTTGAGTGGTTGGAATATCTTTGTTATGGGCT[G/C]
TAGGTTTCTCACACCAATTGGATGAATTAGATCTAAAAATTAGAGGAGAGCATGATTGGATTGCACGCAATTCATTGTTCAAAAGGCACAATTGGTTGGA
TCCAACCAATTGTGCCTTTTGAACAATGAATTGCGTGCAATCCAATCATGCTCTCCTCTAATTTTTAGATCTAATTCATCCAATTGGTGTGAGAAACCTA[C/G]
AGCCCATAACAAAGATATTCCAACCACTCAAAATACAATGAATTATTTTTCCTATTATTACTCTAGCTCTGGCTCCTACAATTTATTGTGTGAATTCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 0.80% | 8.84% | 2.05% | NA |
| All Indica | 2759 | 94.50% | 0.50% | 3.99% | 0.94% | NA |
| All Japonica | 1512 | 74.80% | 1.40% | 19.31% | 4.50% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.97% | 0.00% | NA |
| Indica I | 595 | 79.30% | 0.70% | 15.80% | 4.20% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.10% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.10% | 1.27% | 0.13% | NA |
| Temperate Japonica | 767 | 57.50% | 2.30% | 32.46% | 7.69% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 0.40% | 17.01% | 3.73% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417591194 | G -> C | LOC_Os04g29580.1 | downstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:38.688; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| vg0417591194 | G -> C | LOC_Os04g29590.1 | downstream_gene_variant ; 2997.0bp to feature; MODIFIER | silent_mutation | Average:38.688; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| vg0417591194 | G -> C | LOC_Os04g29580-LOC_Os04g29590 | intergenic_region ; MODIFIER | silent_mutation | Average:38.688; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| vg0417591194 | G -> DEL | N | N | silent_mutation | Average:38.688; most accessible tissue: Callus, score: 65.996 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417591194 | NA | 4.16E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591194 | 1.82E-06 | NA | mr1342_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417591194 | 1.87E-06 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |