\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417591194:

Variant ID: vg0417591194 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17591194
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGAATTCACACAATAAATTGTAGGAGCCAGAGCTAGAGTAATAATAGGAAAAATAATTCATTGTATTTTGAGTGGTTGGAATATCTTTGTTATGGGCT[G/C]
TAGGTTTCTCACACCAATTGGATGAATTAGATCTAAAAATTAGAGGAGAGCATGATTGGATTGCACGCAATTCATTGTTCAAAAGGCACAATTGGTTGGA

Reverse complement sequence

TCCAACCAATTGTGCCTTTTGAACAATGAATTGCGTGCAATCCAATCATGCTCTCCTCTAATTTTTAGATCTAATTCATCCAATTGGTGTGAGAAACCTA[C/G]
AGCCCATAACAAAGATATTCCAACCACTCAAAATACAATGAATTATTTTTCCTATTATTACTCTAGCTCTGGCTCCTACAATTTATTGTGTGAATTCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 0.80% 8.84% 2.05% NA
All Indica  2759 94.50% 0.50% 3.99% 0.94% NA
All Japonica  1512 74.80% 1.40% 19.31% 4.50% NA
Aus  269 97.00% 0.00% 2.97% 0.00% NA
Indica I  595 79.30% 0.70% 15.80% 4.20% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.40% 1.10% 0.55% 0.00% NA
Indica Intermediate  786 98.50% 0.10% 1.27% 0.13% NA
Temperate Japonica  767 57.50% 2.30% 32.46% 7.69% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 78.80% 0.40% 17.01% 3.73% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 88.90% 2.20% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417591194 G -> C LOC_Os04g29580.1 downstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:38.688; most accessible tissue: Callus, score: 65.996 N N N N
vg0417591194 G -> C LOC_Os04g29590.1 downstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:38.688; most accessible tissue: Callus, score: 65.996 N N N N
vg0417591194 G -> C LOC_Os04g29580-LOC_Os04g29590 intergenic_region ; MODIFIER silent_mutation Average:38.688; most accessible tissue: Callus, score: 65.996 N N N N
vg0417591194 G -> DEL N N silent_mutation Average:38.688; most accessible tissue: Callus, score: 65.996 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417591194 NA 4.16E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417591194 1.82E-06 NA mr1342_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417591194 1.87E-06 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251